Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091551-0 Similarity: 0.984 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA091551-0
Gene: RNF181
MFE: -25.767
ENS: 0.899
Length: 91.
Predicted Ligands:
SAM - 6/20
TPP - 5/20
Ni/Co - 3/20
RS: URS0000C0583F_1522368
MFE: -32.999
Ligand: TPP
Species: Modestobacter caceresii TPP riboswitch (THI element)
RS: URS0000C2AFB3_1660136
MFE: -28.218
Ligand: fluoride
Species: Rhodanobacter sp. SCN 69-32 Fluoride riboswitch
RS: URS0000D9211C_1349820
MFE: -34.760
Ligand: fluoride
Species: Arthrobacter sp. AK-YN10 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091551-0 URS0000C0583F_1522368 URS0000C2AFB3_1660136 URS0000D9211C_1349820
Length 91. 91. 91. 89.
Similarity - 0.984 0.981 0.981
Ensemble Norm 0.899 - - -
MFE -25.767 -32.999 -28.218 -34.760
Ligands - TPP fluoride fluoride
Gene RNF181 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.012 7.004 3.002
Length SE - 0. 0. 4.
Lev Distance - 21. 23. 20.
UBS 5. 4. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 0. 0. 1.
H 3. 3. 3. 3.
BL 1. 1. 2. 1.
BR 1. 0. 3. 0.
UN 0.242 0.352 0.308 0.202

Sequences

Field Description
UTR seq + 25 gguccgagggcugugucagaaggcugggcagccauggcguccuauuucgaugaacacgacugcgagATGGCGTCCTATTTCGATGAACACG
UTR dot + 25 …(((..((((((.((((….)))))))))).)))((((…….))))……….((((((((….))))))))………
RS 1 seq GAGCGGGAGCUCGGGCGCACCGGGCUGAGAGGGCAGCAGAAGGCGUUGCCGACCGCAUGAACCUGACCGGGUAAUGCCGGCGGAGGGACUC
RS 1 dot …….(((((((…..)))))))…..((((((…….))))))…………(((.((((……)))))))……..
RS 2 seq CUCCAUGAGGGAGAUGGCAUGCCUCCCGUUCCCCGGCGGAACGAACCGCCCCGCACGACCCAUCGCAGGGGCUGAUGAUGCCUGCACCACC
RS 2 dot ……..(((.(((((……..))))).)))(((((……)))))…………..(((((.((….).).)))))……
RS 3 seq UCUGUUCACGGUGAUGGAUCCCGCCGGAACAGCCCGCACGCGCGUGGGCUUGUUCGAACCGCCUCCUGGCUAAUGGUUCCUACCUUUGC
RS 3 dot .((((((.(((((……..)))))))))))(((((……)))))…….((((((((….)))….)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table