Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091571 Similarity: 0.949 Similarity: 0.945 Similarity: 0.945
UTR: 5HSAA091571
Gene: RNF185
MFE: -67.366
ENS: 0.871
Length: 179.
Predicted Ligands:
cobalamin - 11/20
Mg2+ - 7/20
lysine - 2/20
 RS: URS0000D7A79C_159291
MFE: -57.324
Ligand: Mg2+
Species: Spirochaeta americana M-box riboswitch (ykoK leader)
 RS: URS0000D8D073_1834094
MFE: -80.866
Ligand: Mg2+
Species: Mycobacterium sp. 852002-51057_SCH5723018 M-box riboswitch (ykoK leader)
 RS: URS0000BFC052_397290
MFE: -37.923
Ligand: lysine
Species: Lachnospiraceae bacterium A2 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091571 URS0000D7A79C_159291 URS0000D8D073_1834094 URS0000BFC052_397290
Length 179. 180. 178. 177.
Similarity - 0.949 0.945 0.945
Ensemble Norm 0.871 - - -
MFE -67.366 -57.324 -80.866 -37.923
Ligands - Mg2+ Mg2+ lysine
Gene RNF185 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.005 10.007 6.012
Length SE - 1. 1. 4.
Lev Distance - 63. 67. 65.
UBS 12. 14. 12. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 3. 3. 4. 3.
H 4. 6. 6. 3.
BL 4. 5. 2. 4.
BR 3. 3. 2. 5.
UN 0.017 0.089 0.101 0.124

Sequences

Field Description
UTR seq + 25 aagucccuccgagaggggcggcuccgcgucaugugacuggaguccgcguaggaggggucggaggucuuacccaacagauugacgcggcguuaguauuggccguguacccgaaaaacugauugacugggcuggcguuaacugugcggaggcagagATGGCAAGCAAGGGGCCCTCGGCCT
UTR dot + 25 ..(((((((…))))))).((((((.(((….)))))))))((((((((..((.(((((.((((…………..((((((((……….))))))).)…………..))))…))))).))..))))))))((((.(((..(((………)))))).))))
RS 1 seq CCAUGCCUUUGUGAGGUGAGGCUCCUGCGUGGAUAUACGCCGCUGCCCCGAAAUGUCGAGAGACGCCAAGGGGUUGAACAGGCAGAUUCGGAUUAAGGAUCUGCAUAACGCGGCUCAAGCGAAACCCUGAGAGGUUUCCAAACGCCCCGCAGUGCUAAAACCGCAACGAGGAAGGCCUGU
RS 1 dot ….(((((……..)))))..(.(((((….))))).)(.(((((….((((….))))….))))).)…..((((((((…….))))))))….((.(((….(.((((((……)))))))….))).))(((.(((….((…….))..)))))).
RS 2 seq CAUGCACCUCGCUAGGUGAGGCGUCCGCACGGAUAAAGGCCACUGACCUCGAACGUCGAAAGACGCCCAGGGUCAGGACAGCUCUUCCCGGCUUAAGGGUUGAGCCCAAGUGGCUUCCGGCCGUUGCUUCGGCCGGAUACGCCGUGCGGUGCCGAAGCUCUGACGAGAGGGGUGCCGU
RS 2 dot ….(((((….))))).(((((((….))))….))).(((((((.(..((((….))))..).)))))))….((((..(((…….)))..))))……(((.((((((((……))))))))…)))..((((((((….((((….)))).))))))))
RS 3 seq AAAUUAGAUAGAGGUUGCGUGGUUCAUAAGUAGUUUACUGGAUGUGGCAGGCACAGGGGAUAGUAAAUGAAAGGGGAGGGCGCCGAAAGAAUUUCUUUUCCUGAGGGGGGAUUCUUGGGCAUAUAGUGAACAAUUAUAUGACUGUCAUCUUGCGAUGGAUGGAGCGCUAUCAGAUUA
RS 3 dot ……………(((.((.(.(((.((((…))))..))).).)).)))(((((((((((..((((………..(((..(((((((((((((….))))))))))))).)))………….))))…)))))).))))).(((((……..)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table