Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091682 Similarity: 0.957 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA091682
Gene: RNF32
MFE: -38.710
ENS: 0.879
Length: 186.
Predicted Ligands:
cobalamin - 19/20
lysine - 1/20

 RS: URS0000C627CF_1384057
MFE: -42.858
Ligand: lysine
Species: Lysinibacillus sinduriensis BLB-1 = JCM 15800 Lysine riboswitch
 RS: URS00023281A5_1262951
MFE: -47.893
Ligand: cobalamin
Species: Ruminococcus sp. CAG:17 Cobalamin riboswitch
 RS: URS0002327337_1797914
MFE: -48.339
Ligand: cobalamin
Species: Desulfobacterales bacterium RIFOXYA12_FULL_46_15 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091682 URS0000C627CF_1384057 URS00023281A5_1262951 URS0002327337_1797914
Length 186. 185. 186. 186.
Similarity - 0.957 0.953 0.953
Ensemble Norm 0.879 - - -
MFE -38.710 -42.858 -47.893 -48.339
Ligands - lysine cobalamin cobalamin
Gene RNF32 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 4.005 2.003
Length SE - 1. 0. 0.
Lev Distance - 55. 61. 63.
UBS 12. 11. 13. 12.
BS 0. 0. 0. 0.
ILL 5. 6. 5. 4.
ILR 7. 7. 6. 7.
H 2. 2. 3. 2.
BL 3. 3. 3. 3.
BR 3. 2. 2. 2.
UN 0.151 0.081 0.081 0.204

Sequences

Field Description
UTR seq + 25 gucaccgcgcgcuuccugcaugaguggaaccucagaaaacggucagcgggguucagaaggcaggagauaacaccaagacccuaccagaagaauagaaggaaggugauaggaugugaugauagaauuugugauagccaagcaacaacuuuuccuaauucggcATGTTAAAAAATAAGGGTCACTCAT
UTR dot + 25 …………(((((((…….(((((((.((……))…)))))))…..)))))))……….((((((((..(..((((…(((((((((…((.(((.((((……)))).))).))…))…..))))))).))))..)..))………))))))……
RS 1 seq GAACAAGAUAGAGGCGCAAGUUGCAAUAGUAGACUUUCUGGAGGAUGGACAAUACCGUUGAAGGGGAGGGAAAGGGUAACUUGCCGAAGUGAUAAAUCCAUUGUCUCGGUUUAUUUGCUGGUUUUGCAUUGAAGAAAUGCAAGAUUGUCAGAAUCAGAUUAGGAUUCUGGAGGGCUAUCUAAACG
RS 1 dot ……………(((((((((..(……((((((….(((((……)))))…))))))….)..)))))))))((….((((..((((..((((.(((((.((((.((((((((((((…..)))))))))))).))))…))))).))))..))))….))))….))
RS 2 seq AAACAAUUACCGGUUUUAAGUUCUCUGCCACAUCGGCAGGGCCAAGAGGGAACAGGGUGAGAAUCCCAGGCAGUCGUGCUACUGUAUUUGUUUAGAUCUUUCUGUAACCAUUGUACGGAUCUGUAUGAGAAGGGGAGGGAUCGUGAUUACAUAAGCCAGGAUACCUGCUUAAAGCUGCUACCAGUU
RS 2 dot ……(((((.(((((…..(((((((…..)))))))…….)))))..)))))…….((((((((.((((..((((…(((..(((((((((….((.(((((((….)))))))…)))))))))))..)))))))..))).).))…))))))..(((((….)))))
RS 3 seq UUUUUAUAAAUAAGGAUCAAUUUUAGGGAUUGCUCUGGUCAACGGAACACGGUGAAACUCCGUGGCGGUCCCGCCGCUGUAACCGGAAAUAUCUGUUUUGGGCUGAUGCCACUGUGAAAACGGGAAGGUGAUCAAAACAGGUUUAAUGCCGGGAGCCAGAAGACGAGCCGGGCGAUCAUAAAACGU
RS 3 dot ……………………..((((((((.((((((.((…..)).)))….))).))))))))(((((((((..((((….((((((((((..(….(((.((((….))))…))))..))))))))))……))))..))………)))..))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table