Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091688 Similarity: 0.961 Similarity: 0.960 Similarity: 0.958
UTR: 5HSAA091688
Gene: RNF32_0
MFE: -31.363
ENS: 0.962
Length: 152.
Predicted Ligands:
cobalamin - 9/20
SAM - 6/20
FMN - 4/20
 RS: URS0000C4F02C_1736429
MFE: -57.622
Ligand: FMN
Species: Rhizobium sp. Root1212 FMN riboswitch (RFN element)
 RS: URS0000ABA0F3_377431
MFE: -47.
Ligand: FMN
Species: Chlorobium ferrooxidans DSM 13031 FMN riboswitch (RFN element)
 RS: URS000231DB6E_1211777
MFE: -44.786
Ligand: cobalamin
Species: Rhizobium mesoamericanum STM3625 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091688 URS0000C4F02C_1736429 URS0000ABA0F3_377431 URS000231DB6E_1211777
Length 152. 152. 152. 151.
Similarity - 0.961 0.960 0.958
Ensemble Norm 0.962 - - -
MFE -31.363 -57.622 -47. -44.786
Ligands - FMN FMN cobalamin
Gene RNF32 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 6. 5.001
Length SE - 0. 0. 1.
Lev Distance - 47. 51. 52.
UBS 13. 12. 12. 12.
BS 0. 1. 0. 0.
ILL 4. 5. 4. 3.
ILR 5. 3. 3. 5.
H 3. 3. 4. 2.
BL 3. 5. 3. 4.
BR 4. 4. 4. 5.
UN 0.092 0.086 0.072 0.126

Sequences

Field Description
UTR seq + 25 acgggaacgaccacagccaccgcagggaaacaaccggggcccaggcccagcagaagaauagaaggaaggugauaggaugugaugauagaauuugugauagccaagcaacaacuuuuccuaauucggcATGTTAAAAAATAAGGGTCACTCAT
UTR dot + 25 ..((……))…(((.(((…(….)…))))))…((((((((((..((((…(((((((((…((.(((.((((……)))).))).))…))…..))))))).))))..).))))………)))))……
RS 1 seq CGUAGUUCUCAGGGCGGGGUGAAACUCCCCACCGGCGGUAACGGACAGCAAUGCCCGGAGCCCGCGAGCGCUUCCGGUUUCACGCCGGAAGGUCAGCAGAUCCGGUUGAAUUCCGGAGCCGACGGUCACAGUCCGGAUGGAAGAGAGCAAAC
RS 1 dot ….((((((.(((.(((……))))))((((.((((..((((…(((…(((((..(.((..((.((((((((…..))))))))))..)).).))))))))…))))..)))).))))…..(((….))).))))))….
RS 2 seq ACCUGUUCUCAGGGCGGGGUGAAAAUCCCCACCGGCGGUAUACCGGCUGUUAAUCCGGAAAGCCCGCGAGCGCUUUCGAUUAUUUCGAAAGGUCAGCAGAUUUGGUGAAACUCCAAAGCCGACGGUUAUAGUCCGGAUGAAAGAGGAUAGCG
RS 2 dot .((((….))))..((((…….)))).((((…….))))((.((.(((((((….(((((…(((((.((…(((((..(((((….)))))..))))).)).))))))).)))……)))))))..)).))…….
RS 3 seq GCAUGAAGUCUCGUUGACAGGUACGAGGCGGCAGAUAUAACGGUUAUGUUGUGGGUUUGGAAACCGGUGAAAUUCCGGUGCGGUCGCGCCACUGUGAUCAGGAUGAGGAUACCUCGGACUGGAAGUCAGACCCUGCCACACAACGAUUCUC
RS 3 dot …((..(((((((……..)))))))..))………(((.(((.((((((((((…(((((((…(((.((.(((((((……)))))).).))..)))….))..)))))…)))))))).)).))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table