Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091695 Similarity: 0.969 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA091695
Gene: RNF32_1
MFE: -25.005
ENS: 0.985
Length: 131.
Predicted Ligands:
SAM - 16/20
TPP - 2/20
cobalamin - 1/20
 RS: URS0000C5CEF5_999898
MFE: -42.654
Ligand: SAM
Species: Desulfitobacterium sp. enrichment culture clone CEB3 SAM riboswitch (S box leader)
 RS: URS0000AB1E23_320771
MFE: -43.429
Ligand: TPP
Species: Pedosphaera parvula Ellin514 TPP riboswitch (THI element)
 RS: URS0000C208B3_414996
MFE: -47.850
Ligand: SAM
Species: Actinopolyspora sp. YIM 90600 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091695 URS0000C5CEF5_999898 URS0000AB1E23_320771 URS0000C208B3_414996
Length 131. 130. 131. 131.
Similarity - 0.969 0.969 0.968
Ensemble Norm 0.985 - - -
MFE -25.005 -42.654 -43.429 -47.850
Ligands - SAM TPP SAM
Gene RNF32 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 3.004 7.005
Length SE - 1. 0. 0.
Lev Distance - 38. 41. 40.
UBS 11. 12. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 2. 3. 2. 3.
H 4. 4. 3. 3.
BL 4. 4. 4. 6.
BR 4. 2. 3. 3.
UN 0.092 0.092 0.153 0.160

Sequences

Field Description
UTR seq + 25 gcgcggaggcgggcguugcuacggcaacgcagaagaauagaaggaaggugauaggaugugaugauagaauuugugauagccaagcaacaacuuuuccuaauucggcATGTTAAAAAATAAGGGTCACTCAT
UTR dot + 25 .(((….))).(((((((….)))))))….((((…(((((((((…((.(((.((((……)))).))).))…))…..))))))).))))(((.(.(((…..))).))))……
RS 1 seq CACUCAUCAAGAGCGGCGGAGGGACUGGCCCGAUGAUGCCCGGCAACCGGUAGUCGGUGGGAGCUCUUUAAUGGAGCUUCGGACUACGAGGUGCUAAUUCCUGCAGAACAUGAGUUCUGAGAGAUGAGAG
RS 1 dot ..(((…..)))(((((..(((…..)))..))….)))((.(((.((((((.(…(((((((…..)))))))).))))))..)))))….((((.((((((….)))))))).))……
RS 2 seq AAACGAUUUACGGGGAGCCGACCGGUCCCACAUGGGUGGGAAAAGGCUGAGAGUGUUGUGCGGGAGCGCAACAGACCCUUUGAACCUGCUCCAGGUAAUGCUGGCGAAGGGAACUGAGCUUCUCCAGACUU
RS 2 dot …………((((.((….))))))((.((((((((.(((((….(..((((((((….))))))))..))))))…))))).))).))….((((.((((………)))).))))….
RS 3 seq AGCUCAUCCAGAGGGGCAGAGGGAUCGGCCCGACGAAGCCCCGGCAACCAGCGUCGAAACCGCCAUCGCGUUCGUGGUGCGGGUCGACGAAAACGGUGCCAAUUCCGACCCGCCAGCGGGACAGAUGAGGG
RS 3 dot …………(((((.(.(((…..)))..)…)))))(((.(((..((((((..(((.((((((….))))))))).))))))…..))))))…((.(.((((….)))).).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table