Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091780 Similarity: 0.965 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA091780
Gene: RNF5
MFE: -42.387
ENS: 0.765
Length: 152.
Predicted Ligands:
FMN - 9/20
cobalamin - 5/20
SAM - 4/20
RS: URS0000C46322_1690815
MFE: -66.
Ligand: SAM
Species: Pseudonocardia sp. HH130630-07 SAM riboswitch (S box leader)
RS: URS0000DA5183_445576
MFE: -58.850
Ligand: SAM
Species: Pseudonocardia sp. AL041005-10 SAM riboswitch (S box leader)
RS: URS0000C1945F_1641402
MFE: -59.
Ligand: SAM
Species: Pseudonocardia sp. HH130629-09 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091780 URS0000C46322_1690815 URS0000DA5183_445576 URS0000C1945F_1641402
Length 152. 151. 154. 154.
Similarity - 0.965 0.961 0.961
Ensemble Norm 0.765 - - -
MFE -42.387 -66. -58.850 -59.
Ligands - SAM SAM SAM
Gene RNF5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 1. 1.
Length SE - 1. 4. 4.
Lev Distance - 45. 47. 47.
UBS 12. 13. 13. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 5. 5. 5. 5.
BR 6. 5. 6. 6.
UN 0.145 0.139 0.136 0.136

Sequences

Field Description
UTR seq + 25 aauagugauuaggaaaccuugaagccugcccaacgaucgugggcaggaggugguuucugguuuguuggggcguguguauguguauuuggggggacugaaggguacguggggcgaaacaaaaccggccATGGCAGCAGCGGAGGAGGAGGACG
UTR dot + 25 ………..(((((((……((((((((…….))))))))….)))))))((((((((..(.(.(((((((.(…(((((…..)))))).))))))).).)..)))))).))..((.(.((….)).).))………
RS 1 seq GGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUUGAAGCCCCGGCAACCGGCGUCGCACGACGAUCCGCCCGAGCCGCGCACCCGCGUGGCGAGGACGUCGACGAACACGGUGCCAAUUCCGCCCGCCGCUUCCGGCGGGACAGAUGAGGA
RS 1 dot …………(((((((.(((…..))).))…)))))(((.((((…(((..(((((.(((.(….(((((((….)))))))).)))))))).)))…)))))))…((.((((((((….))))))).).))……
RS 2 seq GGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUUGAAGCCCCGGCAACCGGCGUCGCACGACGAUCCGCCCAGACCUGCGCAUUCCGCGUGGCGAGGACGUCGACGAACACGGUGCCAAUUCCGGCCCGCCACGUCCGGCGGGACAGAUGAGGA
RS 2 dot …………(((((((.(((…..))).))…)))))(((.((((…(((..(((((.((((((…….((((…..)))))))).)).))))).)))…)))))))…((.(.((((((……)))))).).))……
RS 3 seq GGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUUGAAGCCCCGGCAACCGGCGUCGCACGACGAUCCGCCCAGACCUGCGCCUUCCGCGCGGCGAGGACGUCGACGAACACGGUGCCAAUUCCGGCCCGCCACCUCCGGCGGGACAGAUGAGGA
RS 3 dot …………(((((((.(((…..))).))…)))))(((.((((…(((..(((((.((((((…….((((…..)))))))).)).))))).)))…)))))))…((.(.((((((……)))))).).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table