Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091781 Similarity: 0.962 Similarity: 0.959 Similarity: 0.955
UTR: 5HSAA091781
Gene: RNF5_0
MFE: -53.810
ENS: 0.795
Length: 183.
Predicted Ligands:
cobalamin - 19/20
lysine - 1/20

 RS: URS0002329AB1_1078020
MFE: -77.898
Ligand: cobalamin
Species: Mycobacterium thermoresistibile ATCC 19527 Cobalamin riboswitch
 RS: URS0000B31B74_1183432
MFE: -61.319
Ligand: cobalamin
Species: Agrobacterium genomosp. 3 str. CFBP 6623 Cobalamin
 RS: URS000232FE61_1700846
MFE: -45.137
Ligand: cobalamin
Species: Lysinibacillus sp. F5 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091781 URS0002329AB1_1078020 URS0000B31B74_1183432 URS000232FE61_1700846
Length 183. 182. 183. 184.
Similarity - 0.962 0.959 0.955
Ensemble Norm 0.795 - - -
MFE -53.810 -77.898 -61.319 -45.137
Ligands - cobalamin cobalamin cobalamin
Gene RNF5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 6. 8.001
Length SE - 1. 0. 1.
Lev Distance - 49. 53. 56.
UBS 10. 11. 11. 11.
BS 4. 4. 3. 5.
ILL 3. 4. 3. 4.
ILR 3. 3. 2. 3.
H 2. 3. 3. 2.
BL 4. 4. 5. 3.
BR 5. 5. 4. 3.
UN 0.120 0.077 0.120 0.158

Sequences

Field Description
UTR seq + 25 gaauucuuugugacuggcaggcauucagaccaauagugauuaggaaaccuugaagccugcccaacgaucgugggcaggaggugguuucugguuuguuggggcguguguauguguauuuggggggacugaaggguacguggggcgaaacaaaaccggccATGGCAGCAGCGGAGGAGGAGGACG
UTR dot + 25 …((((((((..(((.(((((…….((((((..(((((((((((((…..((((((((…….))))))))))))..)))))))))))))))(((((.(.((((((..(((.((….)).)))..))))))).)))……..)).))).)).)))..))))))))……..
RS 1 seq GUCUCGGCCCUCGAGGACGGUCGCAUCCGUACAACGCGGAUGCCAGGGAACCCGGUGCGAAUCCGGGACUGGCGCGCAGCGGUAUGGGGGACGGACCCGACAUCGGCCACUGGAGCAAUCCGGGAAGGCGUCGCGUCCGGGCGAUCCCGAGUCCGAAGACCUGCCGUCCUCGCUGGUGUCCA
RS 1 dot …..(((((.((((((((((.(…((((((..((((..((((((….(((((…….))))).))))))))).)..))))))(((((((((.((((….(((.(((((….)))))…))))))).)))))…..))))..(((….)))).))))))))))..)).)))..
RS 2 seq UCAUAAGUUUUCUCGUCAGGUGCCCGCCCUUGCGGCGGGAGAAUCGGGAAUUCGGUGAAAAACCGGAACGUGCCCAGCGCUGUGAGGCGGAUGCCCUUUUCAUAAGCCACUGAAGUUAUUCGGGAAGGCGAAAGGGGCGGAUGAAGUCGAGUCAGAAGACCGGCCUGGCAGGAUAGACCGAAC
RS 2 dot ……(((((((.(((((….(((.((((((((((((…..((.(..((((((…..)))))).).)))))…)))))))))))).((((((((((….(((.(((((….)))))…)))))))))))))……((((.(((….)))))))))))).))).))))…..
RS 3 seq GAAUAGCGUGUAGUAAUAGGUGUAAAUUGCGUGCAAUUUGCUUAAAAGGGAAGUCGGUGCGAAUCCGACACUGUCCCGCAACUGUAAAUGUGAGCGACUUUUCAGCAACCACUGUCAAAUGAUGGGAAGGAGAAAAGUGGCAAUGACCAUGAGUCAGGAUACCUGCCUGUUACGAGUACACACC
RS 3 dot …….(((((((((((((((((..(((((((((((((((……((((…(((((((….)).)))))))))……)))))).)).((.(((((((..(..((.(.(((….))))))..)..))))))).))……))))…)))..)))..)))))))))…)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table