Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091782 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA091782
Gene: RNF5_1
MFE: -20.176
ENS: 0.916
Length: 79.
Predicted Ligands:
SAM - 10/20
cobalamin - 7/20
unknown - 1/20
 RS: URS0000D863A1_1697043
MFE: -18.836
Ligand: SAM
Species: Bordetella sp. H567 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C721F4_480391
MFE: -12.833
Ligand: SAM
Species: Pediococcus argentinicus SMK box translational riboswitch (SAM-III)
 RS: URS0000D81AB1_683354
MFE: -22.377
Ligand: SAM
Species: Candidimonas nitroreducens SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091782 URS0000D863A1_1697043 URS0000C721F4_480391 URS0000D81AB1_683354
Length 79. 79. 81. 79.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.916 - - -
MFE -20.176 -18.836 -12.833 -22.377
Ligands - SAM SAM SAM
Gene RNF5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.003 2.003
Length SE - 0. 4. 0.
Lev Distance - 17. 14. 20.
UBS 5. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 1. 1. 0. 0.
H 2. 2. 2. 2.
BL 1. 1. 2. 1.
BR 2. 3. 2. 2.
UN 0.190 0.152 0.247 0.139

Sequences

Field Description
UTR seq + 25 cgaagggccaaaucgcgagcggggcggggcgggcgcgaccuucgaauguaauauATGGCAGCAGCGGAGGAGGAGGACG
UTR dot + 25 ….(.(((…((((…….))))….))).)..((((((..(((………..))).))))))………
RS 1 seq CAUUCGGUUGGCGCCGAUUUGCCUGAUCCGCUUGCGGGCGCCUGAUAAAUCCAGCUAAAGAGGUCUGCAUGACUGCAAC
RS 1 dot ….(((((((((……)))).)).)))(.(((((((..((……………))..))))))).)……..
RS 2 seq UUAGGUUAUGAGCGUUCCCGAUAGGAAUCAUUACUACUAGAUCCUUGUAACCGAAAUUAUUUUAGGGGGAAUUUUAAGUUG
RS 2 dot …(((.((((…((((…..)))))))).)))……(((((.(((………..))).)))))………..
RS 3 seq AUUCGAUUCGGCGCCGAUUUGCCUGAUCCGCUUGCGGGCGCCUCAUAAAUCCAGCUAAAGAGGUCCGUAUGGCCGUCAU
RS 3 dot ….((((.((((……)))).)))).((((((((..(((((……………)))))))))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table