Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091818 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA091818
Gene: RNGTT
MFE: -25.391
ENS: 0.870
Length: 105.
Predicted Ligands:
guanidine - 19/20
glycine - 1/20

 RS: URS0000C82B82_1490057
MFE: -33.881
Ligand: guanidine
Species: Anoxybacillus sp. B7M1 Guanidine-I riboswitch
 RS: URS0000AB8FF4_258594
MFE: -38.628
Ligand: guanidine
Species: Rhodopseudomonas palustris CGA009 Guanidine-I riboswitch
 RS: URS0000C1D0CA_666686
MFE: -23.828
Ligand: guanidine
Species: Bacillus sp. 1NLA3E Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091818 URS0000C82B82_1490057 URS0000AB8FF4_258594 URS0000C1D0CA_666686
Length 105. 105. 105. 105.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.870 - - -
MFE -25.391 -33.881 -38.628 -23.828
Ligands - guanidine guanidine guanidine
Gene RNGTT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 6.001 14.001
Length SE - 0. 0. 0.
Lev Distance - 22. 24. 21.
UBS 8. 6. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 2. 1. 2.
H 3. 3. 3. 3.
BL 2. 1. 2. 1.
BR 3. 1. 1. 0.
UN 0.181 0.190 0.210 0.219

Sequences

Field Description
UTR seq + 25 ggaguugauccugaaugaaaguggcgcgccgccccugacguuacccggaucggagaggaagauucuuaccucugaagacaATGGCTCACAACAAGATCCCGCCGC
UTR dot + 25 ……(((((.(((((..((.((((…)))).))..)))).)..)))))..((((((((…))).)))))………(((……………)))..
RS 1 seq UAAAAAGUUUUCUAGGGUUCCGUGGCUGUUUAGCAGCCAGACUGUGACCGAGAGAAAACGCACAAGCCGCGCUUGUGUACACGGAGGGAUAAAAGCCCGGGAGGA
RS 1 dot ……(((((((..((((.(((((((((…)))))))…)).))))…)))))))((((((((…))))))))…….(((…….)))…….
RS 2 seq AGAGUUGGUGGCUAGGGUUCCGGCCUGUUUCAGGCGCUGGUCCGAGAGCUGCCCCCCGAAGGGAGAAAUCCUUCGGACGCACGGCGGGACAAAAGCCCGGGAGAC
RS 2 dot ……(((((((.(((..(((((((……)).))))))))…)))))))..((((((((…..))))))))……..((((.(….)))))……
RS 3 seq GUUAUUGUUUUCUAGGGUUCCGUGAUCAUUGAUCAGACUGGUCCGAGAGAAAACCCACUACGGCAAAAAUGUAGUGUAACACGGAGGGAUAAAAGCCCGGGAGAG
RS 3 dot ……(((((((.(((..((((((((…)))))…))))))…))))))).(((((((…….)))))))………(((…….)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table