Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091823-12 Similarity: 0.938 Similarity: 0.936 Similarity: 0.934
UTR: 5HSAA091823-12
Gene: RNH1
MFE: -77.722
ENS: 0.898
Length: 205.
Predicted Ligands:
cobalamin - 16/20
unknown - 2/20
Mg2+ - 2/20
 RS: URS0002324228_1843690
MFE: -77.131
Ligand: cobalamin
Species: Pseudomonas sp. 21C1 Cobalamin riboswitch
 RS: URS0002316D38_560556
MFE: -79.297
Ligand: cobalamin
Species: Asanoa sp. 210121 Cobalamin riboswitch
 RS: URS0002312586_1969733
MFE: -76.747
Ligand: cobalamin
Species: Geothermobacter sp. EPR-M Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091823-12 URS0002324228_1843690 URS0002316D38_560556 URS0002312586_1969733
Length 205. 205. 206. 205.
Similarity - 0.938 0.936 0.934
Ensemble Norm 0.898 - - -
MFE -77.722 -77.131 -79.297 -76.747
Ligands - cobalamin cobalamin cobalamin
Gene RNH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 8.003 34.
Length SE - 0. 1. 0.
Lev Distance - 80. 81. 74.
UBS 8. 9. 9. 12.
BS 7. 6. 9. 4.
ILL 3. 1. 4. 4.
ILR 3. 3. 3. 3.
H 3. 3. 3. 5.
BL 5. 4. 4. 5.
BR 4. 5. 3. 2.
UN 0.068 0.137 0.121 0.068

Sequences

Field Description
UTR seq + 25 cacgcaccugaccacgcccacgagccggcucgaacacgcccgcgccgcugacuggcgggugggguugucgacacguucaacccguucugcuggcucgagaacgaaguaggccgucucgcucugggucuccaggcccgcgaccguccgccagucgucccgaggccacucuucaccuccaccATGAGCCTGGACATCCAGAGCCTGG
UTR dot + 25 .(((..(((.((..((..(.(((((((((..((((.(((((((………..)))))))((((((.((…))..)))))))))).))))))))).)..))..))))).)))(..(((((((((.(((((((……………..((((…((((……….))))….))))))))))).)))))))))..).
RS 1 seq AGUAAGGUGGGCGCCGAUGGUUUCGGUUCGCAUUACGCGACCGAAUGAAAAGGGAACAGGGUGCGGCGCGUGUCGCCAAUGCCCUGGCUGCCCCCGCAACUGUAAACGGUUUGCAACGCCCAUUUGCCACUGGCCUGAACCGCUGGGAAGGCGGGCGCUGCGUGAUGUCGUGAGCCAGGAGACCUGCCAUCGCGUUCGGGCCUUA
RS 1 dot ..(((((((((((.(((((((((((((((((((((((((…………(((..(((((((((((….)))))….))))))….)))..(((((((….))))).))..(((((.(((.(((.(((……))).))).)))..))))).))))))))))…))))).)))…..))))))))))))..))))))
RS 2 seq AUGGUCUUGGCCGCAGCUGGUUCGGCCGUCCUCACCGGAUGGCCGAGGCAACAGGGAACCCGGUGUGAAUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCAACGAAGCACUGGGCCUCGGCCUGGGAAGCGACGGCCAGUAGGAACGCGCACGACGCCCACGAGUCCGAAGACCUGCCAGUGCGCCGCAUGCCGU
RS 2 dot (((((..(((.((((.(((….(((((((((..(((…(((((((((..(((….(((((…….)))))..(((..((..((((((.((.(…).))))))))…))..)))))).))))))))))))..)).))))))).(((((….((…(((……..)))))….)))))))))))))))…)))))
RS 3 seq CAAUUUUGUCUGUCCACCGGUGCCCGAGAGGGCCGUGACGCUGACUUAAAUCGGCGUCACGAGGGAAGUGGGGUGCAAAUCCCCCGCGGACCCGCCGCUGUAAGCGAGGACGAAGGGCCGAUAGACCACUGAUCCCCGAGGAUCGGGAAGGCGGCCCGGAGGAUGAUUCGUGAGCCAGAAGACCUGCCGGCCGGACCCCCCACAG
RS 3 dot ….(((((((((.((.((((((((….))))(((((((((((……))))))))))).(((..((((((……..))))))…))))))).))…))..)))))))((((((…..((.(((((((….)))))))…))))))))((.((….((((…(((.(……..).)))))))..))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table