Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA091923 Similarity: 0.968 Similarity: 0.965 Similarity: 0.964
UTR: 5HSAA091923
Gene: RNMT
MFE: -35.479
ENS: 0.963
Length: 137.
Predicted Ligands:
cobalamin - 9/20
TPP - 7/20
SAM - 1/20
 RS: URS0000AB7DBC_339671
MFE: -40.305
Ligand: TPP
Species: Actinobacillus succinogenes 130Z TPP riboswitch (THI element)
 RS: URS0000D7A6A0_1801963
MFE: -53.352
Ligand: TPP
Species: Planctomycetes bacterium RBG_13_60_9 TPP riboswitch (THI element)
 RS: URS0000C0EAE2_1262893
MFE: -46.623
Ligand: SAM
Species: Eubacterium sp. CAG:786 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA091923 URS0000AB7DBC_339671 URS0000D7A6A0_1801963 URS0000C0EAE2_1262893
Length 137. 138. 136. 136.
Similarity - 0.968 0.965 0.964
Ensemble Norm 0.963 - - -
MFE -35.479 -40.305 -53.352 -46.623
Ligands - TPP TPP SAM
Gene RNMT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.005 12.009 3.001
Length SE - 1. 1. 1.
Lev Distance - 40. 40. 46.
UBS 10. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 1. 2. 3. 2.
H 4. 3. 3. 3.
BL 4. 3. 3. 5.
BR 4. 3. 2. 4.
UN 0.190 0.116 0.096 0.162

Sequences

Field Description
UTR seq + 25 aagugacguaagcagacacgcguggcgcgggccgccguuuccgcaaacagaaucgcguuuggcugugcuguguugguucaugaaguuuuaccaucaauucaaguaaucauaaATGGCAAATTCTGCAAAAGCAGAAG
UTR dot + 25 ………..((.((.(((.(((((….)))))))).)).))……….((…..))..((((((..((((((.((((………….)))).).)))))…))))))..((((((….)))))).
RS 1 seq AGGUUCUCAUCGGGGUGCUUAUCGCGGCGACAGCCGGACAAGCUGAGAAAAUACUCGUAGAACCUGAACAGAUUAGGGCUAUUUAUGAAAAAUAAACGGAUCCUAAUAUCUGCGUAGGGAAUUGAGAAACGUCAAUUU
RS 1 dot …((((((…….((((.((.((((….)))))).))))))))))………….((((..((((((((((((.(((((…..))))).)).)))))..)))))..))))(((((((……)))))))
RS 2 seq UGGGGUCGCUAGGGGUGGCCUGCCGGGUGGCGGGCCUGAGAGAAAACCCUCGGAACCUGAUCAGGAUGGGCGGUCUAUGGGCGCCAGUGACGUGUUGGGCCGCUAUGCCUGCGUAGGAAAGCGAUGGACAGAUUGU
RS 2 dot ……..((.(((((((((((((….))))))))………))))).))..((((..((((…(((((((((.(.(((…….))).))))))))))…))))..))))…(((((……)))))
RS 3 seq ACCUUAUCAAGAGCGGCUUCUGGCGUAAUGCGGGGGACUGGUCCCUAUGAAGCCCGGCAACCUCUCCGUUUUCCGGCUCACGGCAAAUGGAAAAGGUGCUACUUCCUGCGGCAGCAUAACUGCCGAAAGAUGAGGA
RS 3 dot ……….((.(((((((((……..)))))).))).))…..((((…(((.((((.(((((((.(((…..))).)))))))..))))))).))))((.((((((…..))))))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table