Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092039 Similarity: 0.940 Similarity: 0.939 Similarity: 0.938
UTR: 5HSAA092039
Gene: ROCK2
MFE: -31.794
ENS: 0.966
Length: 191.
Predicted Ligands:
cobalamin - 12/20
lysine - 4/20
glucosamine - 2/20
 RS: URS0002321A2F_1499688
MFE: -45.866
Ligand: cobalamin
Species: Bacillus sp. LF1 Cobalamin riboswitch
 RS: URS0000AB7927_656519
MFE: -45.126
Ligand: lysine
Species: Halanaerobium hydrogeniformans Lysine riboswitch
 RS: URS0000D84C66_1230338
MFE: -33.984
Ligand: glycine
Species: Moraxella macacae 0408225 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092039 URS0002321A2F_1499688 URS0000AB7927_656519 URS0000D84C66_1230338
Length 191. 191. 191. 194.
Similarity - 0.940 0.939 0.938
Ensemble Norm 0.966 - - -
MFE -31.794 -45.866 -45.126 -33.984
Ligands - cobalamin lysine glycine
Gene ROCK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.015 6.061 7.003
Length SE - 0. 0. 9.
Lev Distance - 78. 80. 67.
UBS 8. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 2. 1. 2.
H 4. 4. 5. 4.
BL 2. 2. 2. 3.
BR 2. 4. 2. 3.
UN 0.351 0.230 0.105 0.294

Sequences

Field Description
UTR seq + 25 uuuugcauugcauaacuuuuuacuacugauccuguacuauuacuguauccuagaugauguauagugauaaauucuaaaggauauauuuuauuuguuuuauaaauuucauauuaaaauuuuauuaaguucuuuguuaucuaaggagaauuguuaucuuuagccucacATGAGCCGGCCCCCGCCGACGGGGA
UTR dot + 25 …(((…)))…………….(((((.((.(((((((((((……….)))))))))))…..)).)))))…………………………………….((((..(((…(((((((………)))))))….))).))))….(((((….))))).
RS 1 seq AAAUAUGAUUAAUAAACAGGUGCUAAAAUCCUUAACCAGAUUUUUAGCUUAAUAGGGAAGUUGGUGAAAAGCCAACGCGGUCCCGCCACUGUAAAUGGGAGCAAACUAUAUUCCGCCACUGUCUAAGAGAUGGGAAGGCAUAGGGAGCAAUGACCAUGAGCCAGGAAACCUGCCUGUUUCUUGCCCGUCUA
RS 1 dot …………………(((((((((……..)))))).)))………..((((((…..))))))(((((((((……….)))))…………))))………..(((((((((((.(((((.((……((……..))….)).))))).)))).))))))).
RS 2 seq GGAUGGGGUAGAGGCGCGAAUUAUAAAUUAGUAACUUAAAGUUUAAUUUAAGCUUAAGAUUUUAAGUGAAAGGUUUAUUCGCCGAAGUGGUUAAUUGAGCUUAAGCAUUUAACUGCUGGGUCUGUAUAAAAUAUGUACAGAACUGUCAUUAAAAGUUUAAUCCAGACUUUUAGUGUUGAGCUAUCUCAAAA
RS 2 dot ………….(.((((…(((((((….(((((((((((…………)))))))))))….))))))))))))..(((((((((.((……..)).))))))))).((((((((((…..)))))))).))..((((((((((((…..))))))))))))(((((….)))))..
RS 3 seq AAUGAUAAAUCUGGAGAGUGUGUUUUUUGUAAAAACACCACCGAAGGGGAAAAAACGACUUUUGACGGCUUAGCAAAUUUACGUUGUUAGCCCAUGUUACAUAUUAUUCUAUACUGCAUUUUAUUCUAUGCUACAUUUUAUGUUGCGUGUCAAAAUUCGUUGAAAAUCUCAGGUAACAGGACAGAUGGGGCACU
RS 3 dot ……………..((((((((((…)))))))).))((((((………..))))))..(((.((((((…….)))))))))………………………………((((.(((((..((((((.((((((……))))……)).))))))….))))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table