Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092111 Similarity: 0.980 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA092111
Gene: RORA
MFE: -16.708
ENS: 0.966
Length: 107.
Predicted Ligands:
TPP - 13/20
glycine - 2/20
tetrahydrofolate - 2/20
 RS: URS0000BFED4F_1400520
MFE: -25.954
Ligand: TPP
Species: Lactobacillus fabifermentans T30PCM01 TPP riboswitch (THI element)
 RS: URS0000DAC93F_1316679
MFE: -40.799
Ligand: TPP
Species: Altererythrobacter xiamenensis TPP riboswitch (THI element)
 RS: URS0000ABD31E_88036
MFE: -36.060
Ligand: TPP
Species: Selaginella moellendorffii TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092111 URS0000BFED4F_1400520 URS0000DAC93F_1316679 URS0000ABD31E_88036
Length 107. 107. 106. 105.
Similarity - 0.980 0.973 0.972
Ensemble Norm 0.966 - - -
MFE -16.708 -25.954 -40.799 -36.060
Ligands - TPP TPP TPP
Gene RORA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.006 15.003 4.003
Length SE - 0. 1. 4.
Lev Distance - 26. 28. 31.
UBS 9. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 1.
ILR 2. 2. 1. 2.
H 2. 2. 3. 2.
BL 5. 6. 3. 6.
BR 5. 5. 3. 6.
UN 0.140 0.065 0.085 0.086

Sequences

Field Description
UTR seq + 25 ggagcguacaagacggugaacugaaugaacgcugagguuugacugcuuauuccuugaugaacccucuguaaaauuuggccgaATGATGTATTTTGTGATCGCAGCGA
UTR dot + 25 ..(.(((…..))).)…………(((((.((((.((.(((((((((((.(((…………..))).))..)))))).))).))…)))).))))).
RS 1 seq UUAGUACACUAGGGGUGUCCAAAAAUGGGCUGAGAUAGCGCUGUAAGUGCUGAUCCCUUUGAACCUGUAAGUUCAGACUUGCGUAGGGAAAGUGUCACAGCUGAUUA
RS 1 dot …(.(((((…))))).)…(((.(((((.((((.(.((((((((.((((…(((………))).))))))))))..)).)….)))).))))).))).
RS 2 seq UACCCAUCCCCGGGGAGCCAUGAGGCUGAGAGGGCGGUUGAAGUCCGCCGACCCGUUGAACCUGAACCUGCUAACACAGGCGGAGGGAGUGGGCUGGUAUCCGCCA
RS 2 dot ..(((……))).((((….))))…..(((((.((.(((((((…(((.(((..((((…………))))))).))).)))))))..)).))))).
RS 3 seq UGGUAGCACCAGGGGUGCUUGUCCGUCUCAGGGACAGGCUGAGAGAGUCCCUUUGCACCUGUGAACAGGUUAAUACCUGCGUAGGGAGCGUGCUGCUUGUGCUGU
RS 3 dot .((.((((((…))))))…))……((.((((((.(.(.(..(((((.((((((((….)))))……..))).))))).).).).)))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table