Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092113 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA092113
Gene: RORB
MFE: -14.135
ENS: 0.895
Length: 74.
Predicted Ligands:
fluoride - 12/20
cobalamin - 5/20
Mg2+ - 1/20
RS: URS000232F9E5_61635
MFE: -12.616
Ligand: cobalamin
Species: Acholeplasma brassicae AdoCbl variant RNA
RS: URS0000BF6B64_204669
MFE: -23.725
Ligand: fluoride
Species: Candidatus Koribacter versatilis Ellin345 Fluoride riboswitch
RS: URS0000DB308C_1797823
MFE: -20.366
Ligand: fluoride
Species: Deltaproteobacteria bacterium GWD2_55_8 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092113 URS000232F9E5_61635 URS0000BF6B64_204669 URS0000DB308C_1797823
Length 74. 75. 73. 76.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.895 - - -
MFE -14.135 -12.616 -23.725 -20.366
Ligands - cobalamin fluoride fluoride
Gene RORB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 5.003 2.
Length SE - 1. 1. 4.
Lev Distance - 15. 15. 14.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 0. 1. 1. 1.
H 1. 1. 1. 1.
BL 2. 1. 0. 2.
BR 1. 0. 1. 1.
UN 0.108 0.160 0.164 0.105

Sequences

Field Description
UTR seq + 25 agugaaaaguaucauauuuuucaguuagacuuuuaauugcuacgucaaaATGCGAGCACAAATTGAAGTGATAC
UTR dot + 25 ……..(((((((….(((((((.(………((((.(((……)))))))).))))))))))))))
RS 1 seq AUGUCAAAUACAAGGUGAAGUUUGGUGAAAAUCCAACACUGUCGCGCAACGGUAAAGUCCGAUCCCUUGUAACGC
RS 1 dot ……..(((((((.((…((((……….(((((((……)))))…)))))))))))))))….
RS 2 seq CAACUUCAUGGCGAUGGAGUUCGCCCUAACCGCCGCAGCCACGUUGCUGCGUGCUGAUAACUCCUGCCGACAC
RS 2 dot ……..(((((..((((((((……..((((((((……)))))).)))))..))))))))))….
RS 3 seq UUUUGAACAGGUGAUGGGGUUCACCUUUUAACCAUCCUGGUCUCAUUCAGACGGGAUUGAUAACCCCUACCAGUGG
RS 3 dot ……((.((((..((((((((……….(((((.((((…..))))))))))))..))))))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table