Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092262 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA092262
Gene: RPAP3
MFE: -17.518
ENS: 0.946
Length: 71.
Predicted Ligands:
homocysteine - 11/20
fluoride - 6/20
SAM - 2/20
 RS: URS0000C4A2C2_1194083
MFE: -23.047
Ligand: fluoride
Species: Tetrasphaera japonica T1-X7 Fluoride riboswitch
 RS: URS0000BE26D0_411473
MFE: -14.692
Ligand: fluoride
Species: Ruminococcus callidus ATCC 27760 Fluoride riboswitch
 RS: URS0000C7DDE4_1262769
MFE: -11.317
Ligand: fluoride
Species: Clostridium sp. CAG:1013 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092262 URS0000C4A2C2_1194083 URS0000BE26D0_411473 URS0000C7DDE4_1262769
Length 71. 71. 71. 72.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.946 - - -
MFE -17.518 -23.047 -14.692 -11.317
Ligands - fluoride fluoride fluoride
Gene RPAP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.005 3.007 3.009
Length SE - 0. 0. 1.
Lev Distance - 20. 19. 18.
UBS 5. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 1. 0. 0.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 2. 2. 2. 2.
UN 0.296 0.225 0.380 0.389

Sequences

Field Description
UTR seq + 25 gcugacgggguggcagugcggcggguuacggccuggucagaccauaATGACTTCAGCAAATAAAGCAATCG
UTR dot + 25 .(((((.((((.(….((…..))..).)))).)))))……………((…….))…..
RS 1 seq GUGGCCACAGGUGAUGGACCCCACCUGGGGCGAGGCCCCGAACCGCAUCCGCUAAUGGCUCCUGCGACGUU
RS 1 dot .(.(((.((((((……..)))))).))).)……….((((…(((…)))…))))…..
RS 2 seq GUUUCCUUAGGGAAUGAUGUUCUCCCUUGGGAUUCCAAAACCGCUUGAGUGCUGAUGACGUCUGCUUUUUA
RS 2 dot …((((.(((((………))))).))))………………((.(((…))).))……
RS 3 seq GAAUUUCACGGGAAUGAAGUGCUCCCUUGGGAAACCUAAACCGCUUUUUAAGCUGAUGACUUCUGCGAGACA
RS 3 dot …(((((.((((………)))).)))))……………….((.((…..)).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table