Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092334 Similarity: 0.988 Similarity: 0.986 Similarity: 0.984
UTR: 5HSAA092334
Gene: RPL10
MFE: -20.629
ENS: 0.698
Length: 70.
Predicted Ligands:
fluoride - 18/20
Ni/Co - 2/20

 RS: URS0000D9A227_987057
MFE: -22.962
Ligand: fluoride
Species: Burkholderia sp. TJI49 Fluoride riboswitch
 RS: URS0000BFBC90_742767
MFE: -12.883
Ligand: fluoride
Species: Dysgonomonas mossii DSM 22836 Fluoride riboswitch
 RS: URS0000DB5C9E_1801707
MFE: -19.648
Ligand: fluoride
Species: Nitrospirae bacterium RBG_16_43_8 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092334 URS0000D9A227_987057 URS0000BFBC90_742767 URS0000DB5C9E_1801707
Length 70. 71. 69. 70.
Similarity - 0.988 0.986 0.984
Ensemble Norm 0.698 - - -
MFE -20.629 -22.962 -12.883 -19.648
Ligands - fluoride fluoride fluoride
Gene RPL10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 4.031 0.001
Length SE - 1. 1. 0.
Lev Distance - 15. 16. 21.
UBS 4. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 0. 0.
H 3. 3. 2. 3.
BL 1. 1. 0. 1.
BR 0. 0. 0. 0.
UN 0.243 0.254 0.420 0.271

Sequences

Field Description
UTR seq + 25 cucuuucccuucgguguggugaccacugaagauccuggugucgccATGGGCCGCCGCCCCGCCCGTTGTT
UTR dot + 25 ……..((((((((.(….)))))))))…..(((…)))((((((………))))))….
RS 1 seq UCGAUCUACGGAGAUGGCAUUCUCCGCCAACCGCCGCGCCCUCAGGCCCGGCUGAUGAUGCCUGCAGCCGU
RS 1 dot ……..((((((……))))))………(.(((….))))((((((……….)))))).
RS 2 seq CGAAAUUAAGGGAAUGGGACUUCCCUGUUAUAAACCGCUAAUAAAGUAGCUGAUAGUUCCUGCUUAACU
RS 2 dot ……..((((((……))))))……………..((((((..((….))))))))….
RS 3 seq UUUAGUAUCGGCGAUGGAGUUCGCCAUUAACCGCCCCGAUCUUAUCGGGACUGAUGACUCCUACUCUCAG
RS 3 dot ………(((((……)))))………((((((…)))))).((((.((…….))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table