Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092342 Similarity: 0.989 Similarity: 0.988 Similarity: 0.985
UTR: 5HSAA092342
Gene: RPL10_0
MFE: -19.729
ENS: 0.988
Length: 70.
Predicted Ligands:
fluoride - 11/20
cobalamin - 9/20

 RS: URS0000BFBC90_742767
MFE: -12.883
Ligand: fluoride
Species: Dysgonomonas mossii DSM 22836 Fluoride riboswitch
 RS: URS00023316E7_1121353
MFE: -21.396
Ligand: cobalamin
Species: Corynebacterium callunae DSM 20147 Cobalamin riboswitch
 RS: URS0000D81CD9_89059
MFE: -15.292
Ligand: fluoride
Species: Lactobacillus acidipiscis Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092342 URS0000BFBC90_742767 URS00023316E7_1121353 URS0000D81CD9_89059
Length 70. 69. 70. 68.
Similarity - 0.989 0.988 0.985
Ensemble Norm 0.988 - - -
MFE -19.729 -12.883 -21.396 -15.292
Ligands - fluoride cobalamin fluoride
Gene RPL10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.006 2.017 0.
Length SE - 1. 0. 4.
Lev Distance - 14. 15. 16.
UBS 3. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 0. 1. 1.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.343 0.420 0.214 0.353

Sequences

Field Description
UTR seq + 25 ccgcuucggucgcucccgaaauauacgucugucacaguuaacggcATGGGCCGCCGCCCCGCCCGTTGTT
UTR dot + 25 ….(((((……)))))………………((((((…((((….))))…))))))..
RS 1 seq CGAAAUUAAGGGAAUGGGACUUCCCUGUUAUAAACCGCUAAUAAAGUAGCUGAUAGUUCCUGCUUAACU
RS 1 dot ……..((((((……))))))……………..((((((..((….))))))))….
RS 2 seq GGAAGCCGGUCAAAUCCCGGCGCUGACCCGCAACCGUAGAUCGCCUUUAAUUGGUGAUGAGCCGGAUUAC
RS 2 dot ….(((((…….)))))……(((…..((..((((((…….))))))..)))))…..
RS 3 seq AUGUUUUCUGGUGAUGACGUUCACCAGUCCAAAAAUCCGUGCUCCCACGUAAUGACGUCUAAGUGAAU
RS 3 dot …….(((((((……)))))))………….(((…((((….))))…)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table