Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092362 Similarity: 0.976 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA092362
Gene: RPL12
MFE: -43.195
ENS: 0.980
Length: 113.
Predicted Ligands:
SAM - 9/20
glycine - 3/20
TPP - 3/20
 RS: URS0000AB78D0_536227
MFE: -26.284
Ligand: SAM
Species: Clostridium carboxidivorans P7 SAM riboswitch (S box leader)
 RS: URS0000D83A2B_1930764
MFE: -27.096
Ligand: SAM
Species: Sporosarcina sp. P33 SAM riboswitch (S box leader)
 RS: URS0000C891E8_1263025
MFE: -26.366
Ligand: FMN
Species: Firmicutes bacterium CAG:466 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092362 URS0000AB78D0_536227 URS0000D83A2B_1930764 URS0000C891E8_1263025
Length 113. 112. 112. 112.
Similarity - 0.976 0.974 0.974
Ensemble Norm 0.980 - - -
MFE -43.195 -26.284 -27.096 -26.366
Ligands - SAM SAM FMN
Gene RPL12 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 3.001 4.
Length SE - 1. 1. 1.
Lev Distance - 30. 32. 32.
UBS 9. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 5.
ILR 5. 4. 4. 6.
H 1. 1. 1. 1.
BL 2. 1. 2. 3.
BR 2. 1. 2. 2.
UN 0.097 0.018 0.062 0.098

Sequences

Field Description
UTR seq + 25 cucucggcuuucggcucggaggaggccaaggugcaacuuccuucggucgucccgaauccggguucauccgacaccagccgccuccaccATGCCGCCGAAGTTCGACCCCAACG
UTR dot + 25 …((((((((((((..((.((((((…((((………((((..(.((((….))))..)..))))))))….)))))).))..))))..))))).)))……..
RS 1 seq UUCUUAUCCAGAGAGGUGGAGGGACUGGCCCUGUGAAGCCCAACAACCGGCAUUUUAAUAUGUAUCGGUGUUAAUUCCUGCAGAAUAUAGUUCAUAUUCUGGAAGAUAAGAA
RS 1 dot .((((((((((((..(((….(((((…((((…….(((.((((((((……))))..)))))))…….))))….)))))))).)))))))…))))).
RS 2 seq CUCUUAUCGAGAGCGACUGAGGGAAAAGGCCCGAUGAAGUCCAGCAACCCCUUGAAUGAAACAAGGAAGGUGCCAAAUCCUGCAGAAUGGUUUUCCAUCUGAGAGAUAAGCU
RS 2 dot ((((((..((((((.((((.((((…(((…………….((((((((…….)))))..))))))…)))).)))..).))))))….))))))…….
RS 3 seq CAUAUUCUUCGGAAACGAGUGCAUCUCUACCGGCGGUAACAGCCCGCGAGCCGAAAGGCUGAUUCGUUGAAAUUACGAAGCCGACAGACAGUCUGGAUGGGAGAAGAAAUAC
RS 3 dot ….((((((.(….((.((….(((..((((.((((((((..(..((((….))))..)..))))…))))…))))..))))).))….).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table