Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092363 Similarity: 0.963 Similarity: 0.963 Similarity: 0.961
UTR: 5HSAA092363
Gene: RPL12_0
MFE: -49.330
ENS: 0.903
Length: 142.
Predicted Ligands:
cobalamin - 15/20
FMN - 3/20
TPP - 1/20
 RS: URS0002320705_1718951
MFE: -54.885
Ligand: cobalamin
Species: Nocardiopsis sp. TSRI0078 Cobalamin riboswitch
 RS: URS000231894A_161398
MFE: -28.274
Ligand: cobalamin
Species: Pseudoalteromonas phenolica Cobalamin riboswitch
 RS: URS0000C5F271_1678637
MFE: -50.857
Ligand: cobalamin
Species: Streptomyces caatingaensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092363 URS0002320705_1718951 URS000231894A_161398 URS0000C5F271_1678637
Length 142. 143. 144. 141.
Similarity - 0.963 0.963 0.961
Ensemble Norm 0.903 - - -
MFE -49.330 -54.885 -28.274 -50.857
Ligands - cobalamin cobalamin cobalamin
Gene RPL12 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 10. 2.002
Length SE - 1. 4. 1.
Lev Distance - 43. 39. 50.
UBS 12. 14. 10. 12.
BS 0. 0. 0. 0.
ILL 6. 6. 5. 5.
ILR 5. 7. 4. 5.
H 2. 2. 2. 2.
BL 4. 5. 2. 5.
BR 2. 1. 2. 2.
UN 0.099 0.056 0.076 0.057

Sequences

Field Description
UTR seq + 25 auaucuggcuuguccgcgcgauuuccggccucucggcuuucggcucggaggaggccaaggugcaacuuccuucggucgucccgaauccggguucauccgacaccagccgccuccaccATGCCGCCGAAGTTCGACCCCAACG
UTR dot + 25 ..(((..((……))..)))…(((.((.(((((….(((..((.((((((…((((………((((..(.((((….))))..)..))))))))….)))))).))..)))))))))).)))………
RS 1 seq AGCCAUCGGAAACGGUGGGGACGGCGGGAGGGGAGAAUCUGGGAAGUCCGGUGAGAUUCCGGCACAGGCCCGCUGCGGUGAACCGAGCCUCCGUGAAGGAGGACCCGGCAAGUCCGAAGACCGGCCUCGCGCCCGCCCCUUAC
RS 1 dot …(((((….)))))(((..((((.((((((….(((.(((…((((.(…((((..(((.((…(((.(((….))))))..)))))..))))..)))))….)))..)))))..)))).))))..)))…..
RS 2 seq UUGUGUUUUAGACAUCUAGACUUCAUAAUAUGGUUUUUCUGAUUAAUCUUGGGAAUAAGCUGAAACUGCUUAACUGUCCCCGCAACUGUGAAGUGCAUUUAAAUGCACGAAGUCAGAUACCAAGGUCAGAAAAAUCCUCUUGAG
RS 2 dot (((((.(((((….)))))…)))))…((((((((((((….(((((..((…((((…(((((((.(((…(((….)))….))).))))..)))…..)))))).)))))))))))))))))……..
RS 3 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGCACCCCCGCGCACGAGCAGCACGCAACGCCACGGCCCGCGAAAGCCGGAAGGCAAGGGGGCCCGCGCCGAUCCGGGAGCCAGGAGACUC
RS 3 dot ……..((((…..((.((((((((.(((.((..((((.((((….(((….(((.((….((…..))…))..)))…)))….))))..)))).))))).))))))))))))))(((……..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table