Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092382 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA092382
Gene: RPL13A
MFE: -6.395
ENS: 0.849
Length: 47.
Predicted Ligands:
SAM - 14/20
preQ_1 - 2/20
glutamine - 2/20
 RS: URS00021EE0D5_12908
MFE: -8.392
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EE08A_388739
MFE: -14.042
Ligand: SAM
Species: Roseobacter sp. SK209-2-6 SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EDC9D_690417
MFE: -11.692
Ligand: SAM
Species: Paracoccus sphaerophysae SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092382 URS00021EE0D5_12908 URS00021EE08A_388739 URS00021EDC9D_690417
Length 47. 45. 47. 49.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.849 - - -
MFE -6.395 -8.392 -14.042 -11.692
Ligands - SAM SAM SAM
Gene RPL13A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 9.002 2.
Length SE - 4. 0. 4.
Lev Distance - 6. 10. 9.
UBS 4. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 2. 2. 0. 2.
H 1. 1. 1. 1.
BL 3. 1. 2. 2.
BR 1. 0. 3. 0.
UN 0.234 0.267 0.277 0.245

Sequences

Field Description
UTR seq + 25 cuuuuccaagcggcugccgaagATGAACACCAACCCTTCCCGAGGCC
UTR dot + 25 ………..((((.(.((((.((…..))…))))..).))))
RS 1 seq UACAUGCAACGGCUUCCUGACGCGUGAGUGAUAAUCAAUGGAGCA
RS 1 dot ………..(((((.((((((….)))….)))..))))).
RS 2 seq CCUGUCACAACGGCUUCCUGGCGUGACGAGGUGACCUCAGUGGAGCA
RS 2 dot …………(((((((((.((.((…)).)).)))).))))).
RS 3 seq CCCCCACAACGGCUUCCUGGCGUGGCGCGGCCCUGAACCCAAUGGAGCA
RS 3 dot ………..(((((.(((.(((((…)))….)))))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table