Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092383 Similarity: 0.973 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA092383
Gene: RPL13A_0
MFE: -18.750
ENS: 0.869
Length: 101.
Predicted Ligands:
TPP - 7/20
tetrahydrofolate - 6/20
glycine - 4/20
 RS: URS0000D8CAE9_1121291
MFE: -18.266
Ligand: TPP
Species: Clostridium acidisoli DSM 12555 TPP riboswitch (THI element)
 RS: URS0000C17FB8_1660138
MFE: -44.871
Ligand: homocysteine
Species: Rubrivivax sp. SCN 71-131 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D8123B_1895733
MFE: -33.282
Ligand: TPP
Species: Burkholderiales bacterium 70-64 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092383 URS0000D8CAE9_1121291 URS0000C17FB8_1660138 URS0000D8123B_1895733
Length 101. 101. 101. 101.
Similarity - 0.973 0.972 0.971
Ensemble Norm 0.869 - - -
MFE -18.750 -18.266 -44.871 -33.282
Ligands - TPP homocysteine TPP
Gene RPL13A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.005 13.005 6.002
Length SE - 0. 0. 0.
Lev Distance - 34. 32. 36.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 3. 0. 0.
H 2. 1. 3. 3.
BL 5. 5. 4. 4.
BR 5. 4. 2. 4.
UN 0.109 0.178 0.178 0.158

Sequences

Field Description
UTR seq + 25 cacuucugccgccccuguuucaagggauaagaaacccugcgacaaaaccuccuccuuuuccaagcggcugccgaagATGAACACCAACCCTTCCCGAGGCC
UTR dot + 25 ((((((.((.(((.(((((.(.((((……..))))).))))……………….).))).)).)))).))………((((…))))..
RS 1 seq AUUUUUAUGCGGGGGUGCCAUUUUGGCUGAGAGGAUACAAAUCUAACCCUUAGAACCUGAUUUCGGAUAAUACCGGCGUAGGAAGCAUGUUACUGAUGAUG
RS 1 dot .(((((((((.((.((.(((((..(((((((.((.((……)).)))))))..)).)))…))…)).)).)))))))))……………..
RS 2 seq CUUCCCGAGGAGCGUUGCGACGGUCGUUCGACCGCCAGGCUCGGGGCCCCGCGCCGCGUGAGCACGCUGCCGCGCGGGAUCGAGAACGGCGCUCGCCUCCC
RS 2 dot …(((…((((.(((.(.(((((….))))))))))))))))..(((((((.(((((….))).)).)))))))………(((….)))….
RS 3 seq CGAUCUGCUCCGGGGUGCGCAGCACGCUGAGACGGGCCCAGGCCUGAACCCGAGAACUUGAUCCGGUUAGGACCGGCGAAAGAAGAGCGAUCCGUCGCCCC
RS 3 dot ….(((((.(((.((((…)))).))))).)))(((..((((((.(((.((……..)).))))))).)))))………((((….))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table