Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092420 Similarity: 0.977 Similarity: 0.976 Similarity: 0.974
UTR: 5HSAA092420
Gene: RPL17
MFE: -21.657
ENS: 0.841
Length: 110.
Predicted Ligands:
TPP - 14/20
SAM - 4/20
glycine - 1/20
 RS: URS0000C052F9_1420901
MFE: -19.948
Ligand: TPP
Species: Pseudogymnoascus sp. VKM F-3775 TPP riboswitch (THI element)
 RS: URS0000C8A389_1420910
MFE: -20.452
Ligand: TPP
Species: Pseudogymnoascus sp. VKM F-4516 (FW-969) TPP riboswitch (THI element)
 RS: URS0000C103D6_1632859
MFE: -36.569
Ligand: TPP
Species: Arsukibacterium sp. MJ3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092420 URS0000C052F9_1420901 URS0000C8A389_1420910 URS0000C103D6_1632859
Length 110. 109. 109. 111.
Similarity - 0.977 0.976 0.974
Ensemble Norm 0.841 - - -
MFE -21.657 -19.948 -20.452 -36.569
Ligands - TPP TPP TPP
Gene RPL17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 2. 2.001
Length SE - 1. 1. 1.
Lev Distance - 29. 31. 33.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 2. 3. 2.
H 3. 3. 3. 3.
BL 3. 2. 2. 3.
BR 2. 2. 2. 2.
UN 0.145 0.174 0.156 0.117

Sequences

Field Description
UTR seq + 25 gguugacuggauuggugaggcccguguggcuacuucuguggaagcagugcuguaguuacuggaagauaaaaggugaucugugaaaATGCATATACGAAAAGCCACGAAGT
UTR dot + 25 (.((.(((…..))).)).)(((.((((((((..((((….))))….)))))))))))………(((..((((((……))))…))…)))…….
RS 1 seq UAUGAGCAUGACGGGUGUUCGAUGAUUGUUUCGGCAUGACUCGUUCUGAGAAAUUACCGUUGAACUUGAUCUGGAUAAUACCAGCGAAAGGACAUGCUUCUAUCAUACU
RS 1 dot …((((((…..))))))..(((((.((((((.(((…))).)))))))))))..((((..(((…((((……))))…)))..)).))…………
RS 2 seq UAUGAGCAUGACGGGUGUUCAAUGAUUGCUCCGGCAUGACUUGUUCUGAGAAAUUACCGUUGAACUUGAUCUGGAUAAUACCAGCGAAAGGACAUGCUUCUAUCACACU
RS 2 dot ..(((((((…..))))))).(((((.(((.((((…..))))..))).)))))..((((..(((…((((……))))…)))..)).))…………
RS 3 seq GGGUACUUGUCGGAGUGCCCAGCUGUUUACAGCGGGCUGAGACCGUGAAAACGGGAUCCGUUGAACCUGAUCAGGCUAAUACCUGCGAAGGGAAACAAGGGGAAAUACAGC
RS 3 dot ((((((((….))))))))..((((((.((.(((…….))))).))))))..(((.(((..(((…((((……))))…)))….))).)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table