Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092421 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA092421
Gene: RPL17_0
MFE: -27.175
ENS: 0.783
Length: 126.
Predicted Ligands:
TPP - 10/20
molybdenum - 6/20
zmp-ztp - 1/20
 RS: URS0000D94730_36646
MFE: -32.589
Ligand: TPP
Species: Penicillium coprophilum TPP riboswitch (THI element)
 RS: URS0000DA333F_1835702
MFE: -41.312
Ligand: TPP
Species: Penicillium arizonense TPP riboswitch (THI element)
 RS: URS0000DA973F_1817879
MFE: -37.121
Ligand: molybdenum
Species: Candidatus Schekmanbacteria bacterium RBG_16_38_10 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092421 URS0000D94730_36646 URS0000DA333F_1835702 URS0000DA973F_1817879
Length 126. 127. 127. 126.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0.783 - - -
MFE -27.175 -32.589 -41.312 -37.121
Ligands - TPP TPP molybdenum
Gene RPL17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 4.003 3.008
Length SE - 1. 1. 0.
Lev Distance - 36. 39. 41.
UBS 10. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 3. 1. 2. 2.
H 4. 4. 3. 4.
BL 3. 3. 3. 2.
BR 2. 2. 2. 2.
UN 0.111 0.150 0.055 0.198

Sequences

Field Description
UTR seq + 25 gguugacuggauuggugaggcccguguggcuacuucuguggaagcagugcuguaguuacuggaagauaaaagggaaagcaagcccuuggugaucugugaaaATGCATATACGAAAAGCCACGAAGT
UTR dot + 25 (.((.(((…..))).)).)(((.((((((((..((((….))))….)))))))))))…….(((((……..)))))(((..((((((……))))…))…)))…….
RS 1 seq AGCACGCAUGACGGGUGUUCGAGGUCUUGCAUUUUUGGUCUUCCAAAAGCGCGAGUCUUGUUCUGAGAAAUUACCGUUAGAACUUGAUCUGGACAAUACCAGCGAAAGGACAUGCAUGCUUCAUCCC
RS 1 dot (((((.(…..).)))))(((((.(((((.(((((((….))))))).))))))))))((((((……….))))))(((…((((……))))…)))……………….
RS 2 seq AACACGCAUGGCGGGUGUUCGAGAUCUCGCGCUUUUGGUCCGCCGAAAGCGCAAGUCUCGUUCUGAGAUAUUACCGUUAAAACUUGAUCUGGACAAUACCAGCGAAAGGACAUGCAUGUUUCAUCCC
RS 2 dot (((((.(…..).)))))(((((.((.((((((((((….)))))))))).)))))))…((((((((….(((….(((…((((……))))…))))))….))))))))….
RS 3 seq AAAAGGGAAAAACUCCGAGCCAUUUUUUCUAAAUCCUGAGCAAUCAGGACAAGAGAUAUGGCCGUUAGGUGACUCUGGAAACGGAAUCGCCCCCCGUGUUCGGAAAGGAGAUAAUGUGUAGGCUUU
RS 3 dot ….(((…..)))((.(((((..(((((…((((((….))))))..))))).)))))))…(((((.((((….)))).)))))(((((….)))…))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table