Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092431 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA092431
Gene: RPL18A
MFE: -18.230
ENS: 0.857
Length: 60.
Predicted Ligands:
unknown - 15/20
glutamine - 4/20
fluoride - 1/20
 RS: URS0000E60977_1817861
MFE: -20.335
Ligand: unknown
Species: Candidatus Firestonebacteria bacterium RIFOXYC2_FULL_39_67 nhaA-I RNA
 RS: URS0000E606D1_1801856
MFE: -20.546
Ligand: unknown
Species: Omnitrophica WOR_2 bacterium RIFCSPHIGHO2_02_FULL_48_11 nhaA-I RNA
 RS: URS0000E60062_1801836
MFE: -20.336
Ligand: unknown
Species: Omnitrophica WOR_2 bacterium RBG_13_44_8b nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092431 URS0000E60977_1817861 URS0000E606D1_1801856 URS0000E60062_1801836
Length 60. 60. 58. 60.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.857 - - -
MFE -18.230 -20.335 -20.546 -20.336
Ligands - unknown unknown unknown
Gene RPL18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.014 2.020 7.018
Length SE - 0. 4. 0.
Lev Distance - 15. 12. 15.
UBS 4. 3. 3. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 1. 1. 0.
H 3. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0. 0.217 0.241 0.233

Sequences

Field Description
UTR seq + 25 cuuuugcggguggcggcgaacgcggagagcacgccATGAAGGCCTCGGGCACGCTACGAG
UTR dot + 25 .(((((((..((….))..)))))))…..(((…..)))((((………))))
RS 1 seq GGGUCCUGAAGAAUAUGUUUUAAGCUUCAGGAGGAGAUAUAGAUGGUCGGGCCGCCAUCC
RS 1 dot …((((((((..((…..))..))))))))………((((((……)))))).
RS 2 seq GGGUCCGGAUUUCGGUAGAUUUCCGGAGGAUUCAGCGAAGAUGGUCGGGCCGCCAUCU
RS 2 dot …((((((..((….))..))))))………..(((((((……)))))))
RS 3 seq UGGUCUGGAGAUAAUUAAUUAUCUCUGGAGGUGAUUCUUUAGAUGGUCGGGCCGCCAUCU
RS 3 dot …(((((((((((….)))))))))))………..(((((((……)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table