Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092432 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA092432
Gene: RPL18A_0
MFE: -12.531
ENS: 0.796
Length: 47.
Predicted Ligands:
glutamine - 6/20
SAM - 5/20
unknown - 4/20
RS: URS0000C7DE01_12908
MFE: -8.438
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
RS: URS0000D6C93A_12908
MFE: -16.
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
RS: URS0000C7168F_12908
MFE: -6.675
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092432 URS0000C7DE01_12908 URS0000D6C93A_12908 URS0000C7168F_12908
Length 47. 47. 48. 48.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.796 - - -
MFE -12.531 -8.438 -16. -6.675
Ligands - glutamine unknown glutamine
Gene RPL18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 3.016 1.002
Length SE - 0. 1. 1.
Lev Distance - 10. 14. 15.
UBS 5. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 1.
ILR 1. 1. 2. 1.
H 1. 1. 1. 1.
BL 3. 0. 2. 3.
BR 1. 1. 1. 2.
UN 0.128 0.128 0. 0.083

Sequences

Field Description
UTR seq + 25 cggcgaacgcggagagcacgccATGAAGGCCTCGGGCACGCTACGAG
UTR dot + 25 .((((…((.(((.((.(……..))))))..)).))))…..
RS 1 seq AUCGUUCAUCCUUAAGGACGGAAGUAGGCUAGCCGAAGGAACGCACU
RS 1 dot ..(((…(((((..((..((…….))..)).))))))))….
RS 2 seq GGGUGCAGUCCCGGCACUGCAGGACAACGGAUGGUCGGGCCGCCAUCC
RS 2 dot (((((..(.((((((.(((……..)))…)))))).)..)))))
RS 3 seq AUCGUUUGGCUCAUUGAGUUGGAAGUAAGGUAACUGAAGAAACGCACU
RS 3 dot …((.((..((.((.(((((………))))).))))..)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table