Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092442 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA092442
Gene: RPL21
MFE: -10.586
ENS: 0.964
Length: 68.
Predicted Ligands:
fluoride - 17/20
cobalamin - 2/20
purine - 1/20
 RS: URS0000D9AF55_1797482
MFE: -23.003
Ligand: fluoride
Species: Betaproteobacteria bacterium RIFCSPLOWO2_02_64_14 Fluoride riboswitch
 RS: URS0000BF5DED_555778
MFE: -20.371
Ligand: fluoride
Species: Halothiobacillus neapolitanus c2 Fluoride riboswitch
 RS: URS0000C79322_1140001
MFE: -10.597
Ligand: fluoride
Species: Enterococcus durans ATCC 6056 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092442 URS0000D9AF55_1797482 URS0000BF5DED_555778 URS0000C79322_1140001
Length 68. 70. 68. 68.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.964 - - -
MFE -10.586 -23.003 -20.371 -10.597
Ligands - fluoride fluoride fluoride
Gene RPL21 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 2.001 2.008
Length SE - 4. 0. 0.
Lev Distance - 15. 21. 22.
UBS 6. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 1.
H 2. 2. 2. 2.
BL 2. 1. 2. 2.
BR 2. 1. 2. 1.
UN 0.132 0.157 0.162 0.044

Sequences

Field Description
UTR seq + 25 uuuccuuucggccggaaccgccaucuuccaguaauucgccaaaATGACGAACACAAAGGGAAAGAGGA
UTR dot + 25 ……..(((……)))((.((((((…..((((.((…)).))))…….)))).)))).
RS 1 seq CGGCAAUAGGGAGAUGGCAUUCUCCUCCAACAGGAAACCGCCGGAAACGGCUGAUGAUGCCUGCUGGGUC
RS 1 dot ……..((((((……))))))(((.((((…..((((….))))……..)))).)))…
RS 2 seq CAACGAAAUGGCGAUGGAGUUCGCCGUAACCGCCCCCACUUCUGGUGGCUGAUGACUCCUGAAGGCGC
RS 2 dot …….(((((((……)))))))…((((…..(((.((.(……..).)).))))))).
RS 3 seq AAGUGAAUAGGUGAUGGUGUUCGCCUUUAAACGUUGAUCGUAAGAUAACUAAUGACGCCUACUAAAGA
RS 3 dot ..(((((((……..)))))))(((((…..((.((((.((….)).))))))…..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table