Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092451 Similarity: 0.970 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA092451
Gene: RPL21_0
MFE: -28.
ENS: 0.926
Length: 115.
Predicted Ligands:
TPP - 6/20
FMN - 5/20
methionine - 4/20
 RS: URS0000C395F6_1262774
MFE: -30.886
Ligand: FMN
Species: Clostridium sp. CAG:127 FMN riboswitch (RFN element)
 RS: URS0000C09134_1218169
MFE: -40.786
Ligand: TPP
Species: Pseudomonas putida S11 TPP riboswitch (THI element)
 RS: URS0000E3F3A6_2078786
MFE: -39.491
Ligand: TPP
Species: Pseudomonas sp. JV551A3 TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092451 URS0000C395F6_1262774 URS0000C09134_1218169 URS0000E3F3A6_2078786
Length 115. 115. 115. 115.
Similarity - 0.970 0.970 0.970
Ensemble Norm 0.926 - - -
MFE -28. -30.886 -40.786 -39.491
Ligands - FMN TPP TPP
Gene RPL21 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.033 5.001 5.001
Length SE - 0. 0. 0.
Lev Distance - 39. 39. 39.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 2. 1. 2. 2.
H 3. 3. 3. 3.
BL 3. 2. 2. 2.
BR 4. 4. 2. 2.
UN 0.061 0.243 0.087 0.087

Sequences

Field Description
UTR seq + 25 cuuccagguagggccuacgcguggcucccgggcgcuagguguucgacagacuugaaccgcgaccuuguggccucagaguaauucgccaaaATGACGAACACAAAGGGAAAGAGGA
UTR dot + 25 ….(((((((.((((((((.(((…))).))).))))).))……)))))..(((((….)))))((((…….((((.((…)).))))…………)))).
RS 1 seq AUAUUUACUCGGGGCGGGGUGUGAUUCCCCACCGGCGGUAUAGCCCGCGCGCAGUGAUGCAUGAUUUGGUGAGAUUCCAAAGCCGACAGUAUAGUCUGGAUGAGAGAGUAAGGAU
RS 1 dot ….(((((..(.(((((.((((…((((…)).)))))).))))).)..)))))…….(((((…….))))).(((((……))).))…………….
RS 2 seq AGCGCCACCAAGGGGAGCCCGGCAACGGGCUGAGAAACCGCUGGAUGCUGUAGCGCGGUGACCCUUCGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAUGGGACUUUGAAACCUG
RS 2 dot .((((((((.((.((((((((….))))))……)).)))).))…..))))…..(((((((……..((((……)))))))))))..((……….))..
RS 3 seq AGCGCCACCAAGGGGAGCCUGGCAACGGGCUGAGAAACCGCUGGAUGCUGCAGCGCGGUGACCCUUCGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAUGGGACUUGAAACCUGC
RS 3 dot .((((((((.((.((((((((….))))))……)).)))).))…..))))…..(((((((……..((((……)))))))))))..(((……..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table