Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092461 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA092461
Gene: RPL22L1
MFE: -33.393
ENS: 0.906
Length: 105.
Predicted Ligands:
SAM - 17/20
TPP - 2/20
glycine - 1/20
 RS: URS0000DB2741_1434701
MFE: -21.270
Ligand: SAM
Species: Chishuiella changwenlii SAM riboswitch (S box leader)
 RS: URS0000C602A0_200991
MFE: -29.394
Ligand: SAM
Species: Planococcus rifietoensis SAM riboswitch (S box leader)
 RS: URS0000D85933_1932669
MFE: -24.646
Ligand: SAM
Species: Chryseobacterium sp. JV274 SAM
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092461 URS0000DB2741_1434701 URS0000C602A0_200991 URS0000D85933_1932669
Length 105. 104. 105. 106.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.906 - - -
MFE -33.393 -21.270 -29.394 -24.646
Ligands - SAM SAM SAM
Gene RPL22L1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 4.002 7.008
Length SE - 1. 0. 1.
Lev Distance - 28. 32. 30.
UBS 6. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 3. 1. 2. 1.
H 3. 4. 4. 4.
BL 1. 2. 1. 1.
BR 0. 0. 0. 0.
UN 0.257 0.260 0.210 0.170

Sequences

Field Description
UTR seq + 25 cgcgugacgcagcacgcuuugauauaaaugcagaccgcgcggccguagcuuccucucugcucucgcggccgacucgcaagATGGCGCCGAAAGACAGGAAGCCCA
UTR dot + 25 .(((((……)))))……………….(((((((((((((………)))…)))))))…)))…..(((.((……..))..)))..
RS 1 seq CACUUAUCAAGAAAGGUGGAGGGAAUGGCCUGUAGAAACCUUAGCAACCAGAUGACUCAUAAUCAAAGGUGCUAAAUCCAACCCUAUAAAGGGAUAGAUGAGAU
RS 1 dot (((((……..))))).(((……)))………(((((.(((.(((……..)))…))))))))……((((….))))………..
RS 2 seq CUCUUAUACAGAGAGGUGGAGGGAAGUGCCCGAUGAAGCCCGGCAACCGUCAUGAAAAUGAAAUGGUGCCAAGUCACUCAAAGUGAAAACUUUGAAAGAUGAGAG
RS 2 dot (((((…..)))))…..(((…..)))……….(((.((((((((….))))..)))))))..(((..(((((((….)))))))..)))…..
RS 3 seq GAUUUAUCAAGAAAGGUGGAGGGAUUUGGCCCAAAGAAACCUUAGCAACCUGCACGAUUCGAGAAGUGUAAAGGUGCUAAUUCCAACCCUGAGGGGGAGAUAAGCG
RS 3 dot ..((((((……))))))(((……)))………(((((.((((((((……….))))..)))))))))((((..(((…)))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table