Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092463 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA092463
Gene: RPL23
MFE: -32.125
ENS: 0.807
Length: 115.
Predicted Ligands:
TPP - 13/20
FMN - 3/20
methionine - 1/20
 RS: URS0000BEA35D_1736539
MFE: -53.784
Ligand: methionine
Species: Angustibacter sp. Root456 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000AB27CB_1802
MFE: -40.401
Ligand: TPP
Species: Mycobacterium farcinogenes TPP riboswitch (THI element)
 RS: URS0000C3DF09_1005999
MFE: -32.934
Ligand: TPP
Species: Leminorella grimontii ATCC 33999 = DSM 5078 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092463 URS0000BEA35D_1736539 URS0000AB27CB_1802 URS0000C3DF09_1005999
Length 115. 116. 115. 114.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0.807 - - -
MFE -32.125 -53.784 -40.401 -32.934
Ligands - methionine TPP TPP
Gene RPL23 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 4.002 6.
Length SE - 1. 0. 1.
Lev Distance - 36. 40. 38.
UBS 9. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 2. 1. 3. 2.
H 3. 3. 3. 3.
BL 5. 4. 6. 3.
BR 3. 5. 4. 3.
UN 0.052 0.052 0.096 0.070

Sequences

Field Description
UTR seq + 25 ggccacgugaggagggugggcggggcguuaaaguucauaucccaguguccuuugaaucgacuuccuuuuuucuuuuuuccggcguucaagATGTCGAAGCGAGGACGTGGTGGGT
UTR dot + 25 (.((((.(…..).)))).).((((……))))….((((.(((((.(((..(((((.((…………………….)).)))))..))))))))…)))).
RS 1 seq GGUCAUGAGCGCCAGCGCCAAGCCCCGGCUCGCUGGCCGGCAACCCUCCUGCGCGGCGGGGUGCUCCGGGUGAGGACCAGGCGACGACGGACGCCCCGUCGCCGCAAGCGCGGACU
RS 1 dot (((..((.(((….))))).)))((((((….))))))…(((.(.((((((((((((((.(((((((….)))………))))))))))))))).))).).).))…
RS 2 seq GAACGGCAAUACGGGAGUCCCGGGGACGAGGGGCUGAGAGUGGGCAUACGGACCGGCCCUGACCGUCACACCUGAUCCGGGUCAUGCCGGCGUAGGGAGCGGAGUAUGGCAACAG
RS 2 dot …((……))..((((((……..))))))….((.(.(((((…(((.(((((.(((.((.(((((…)))))..)).)))..)))))..))).))))).).))..
RS 3 seq UUCACCUCAACGGGGUGCUUGCUUAAAAGCUGAGAAUGCGUUCGGUCGCCUGAACCUUACCCGUAGAACCUGAUCCGGUUAAUGCCGGCGGAGGGAUUUGAGAACGCGUAUAGC
RS 3 dot ..(((((…..)))))((((((….))).))).((((((((((((.(((…((…((.(((.((((……))))..))).)).)))))))))…))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table