Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092474 Similarity: 0.973 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA092474
Gene: RPL26
MFE: -27.699
ENS: 0.915
Length: 121.
Predicted Ligands:
molybdenum - 16/20
TPP - 4/20

 RS: URS0000D99FD9_1797291
MFE: -34.234
Ligand: molybdenum
Species: Candidatus Atribacteria bacterium RBG_19FT_COMBO_35_14 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D7F84B_1798585
MFE: -34.234
Ligand: molybdenum
Species: Candidatus Levybacteria bacterium RBG_16_35_6 Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB33FE_696281
MFE: -30.508
Ligand: molybdenum
Species: Desulfotomaculum ruminis DSM 2154 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092474 URS0000D99FD9_1797291 URS0000D7F84B_1798585 URS0000AB33FE_696281
Length 121. 120. 120. 120.
Similarity - 0.973 0.973 0.973
Ensemble Norm 0.915 - - -
MFE -27.699 -34.234 -34.234 -30.508
Ligands - molybdenum molybdenum molybdenum
Gene RPL26 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.001 4.
Length SE - 1. 1. 1.
Lev Distance - 34. 34. 34.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 2. 1. 1. 2.
H 4. 3. 3. 3.
BL 3. 3. 3. 2.
BR 1. 2. 2. 1.
UN 0.190 0.217 0.217 0.208

Sequences

Field Description
UTR seq + 25 auaggucucgcgagaucuuugguaaacuuacagaaccggaagcagcguguaguucucuucccuuuugcggccaucaccgaagcgggagcggccaaaATGAAGTTTAATCCCTTTGTGACTT
UTR dot + 25 ..((((((….))))))…………(((((..(((((.(((…..)))..))))).))))).((((.((.(((…)))))..))))…((((((……..))))))…..
RS 1 seq UAAAAAAAUAUUCUCCGAGCUAUCACACCUAAGGUAGAAACUAUGGUGGAUUAGCCGAUAAGGAAUGAGAGGAAACUCUUAUUCCUCCCGUGUUUGGAAAGGAGGCUUGAUAUGAUGAGU
RS 1 dot ……………((.((((((.((((..((…….))..))))))).)))))…(((((((((((….)))))))))))..((((((.((……..)).))))))……
RS 2 seq UAAAAAAAUAUUCUCCGAGCUAUCACACCUAAGGUAGAUACUAUGGUGGAUUAGCCGAUAAGGAAUGAGAGGAAACUCUUAUUCCUCCCGUGUUUGGAAAGGAGGCUUGAUAUGAUGAGU
RS 2 dot ……………((.((((((.((((..((…….))..))))))).)))))…(((((((((((….)))))))))))..((((((.((……..)).))))))……
RS 3 seq UAAUAUAAUUUUCUCCGAGCCAUCCUACCUAAAACAUUUAUGUCAAGGUAUUUUGGCCGUUAGGGUUAAUCUGGAAAUGGAUUAGCCUCCCUGUUGGAAAGGAGAGCAUUUUCCCGCCUG
RS 3 dot ……………((.((((…(((((…(((….)))..)))))…))))))…(((((((((((….)))))))))))….((.((((((…….)))))).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table