Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092481 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA092481
Gene: RPL26L1
MFE: -22.166
ENS: 0.949
Length: 67.
Predicted Ligands:
fluoride - 11/20
cobalamin - 5/20
SAM - 1/20
 RS: URS0000AB6E2F_1655605
MFE: -8.422
Ligand: SAM
Species: Pelagibacteraceae bacterium BACL5 MAG-120820-bin39 SAM-V riboswitch
 RS: URS0000D69E19_12908
MFE: -22.320
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D929BC_1805218
MFE: -15.327
Ligand: fluoride
Species: Hydrogenophilaceae bacterium CG1_02_62_390 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092481 URS0000AB6E2F_1655605 URS0000D69E19_12908 URS0000D929BC_1805218
Length 67. 67. 66. 68.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.949 - - -
MFE -22.166 -8.422 -22.320 -15.327
Ligands - SAM unknown fluoride
Gene RPL26L1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 7. 5.036
Length SE - 0. 1. 1.
Lev Distance - 25. 23. 24.
UBS 5. 5. 6. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 1. 1. 0.
H 2. 2. 2. 2.
BL 2. 1. 4. 1.
BR 1. 2. 2. 1.
UN 0.060 0.030 0.061 0.250

Sequences

Field Description
UTR seq + 25 gcgcacucagggucugaggcagcuaguagccggagggucaccATGAAGTTCAATCCCTTCGTTACCT
UTR dot + 25 ((((.(((((…))))))).))..(((((.((((((……………..)))))))))))..
RS 1 seq AUAAUCGGUAGGCAUUUGAACUGUAUUGUGCGCCUUACAUAAAGUUAAAGCACUAAAAAAGGAGCAG
RS 1 dot (((((((((……….)))).)))))((.((((……(((……)))….)))).))..
RS 2 seq GGGUUCGAAGGCACACUGUGUGCUUUCGGAGGAUAGACGGGUAGCAAAUGGUCGGGCCGCCAUUCG
RS 2 dot …((((((((((((…))))))))))))((((.(.(((.(.((…..))..).)))).)))).
RS 3 seq UUCAAAGCAGGAGAUGGCAUACCUCCUAAUAACCGCCUGGGUUCCCGGCUGAUGAUGCCUACGCGAAC
RS 3 dot ……..(((((………)))))……(((.(((((…………..))))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table