Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092482 Similarity: 0.974 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA092482
Gene: RPL26L1_0
MFE: -32.382
ENS: 0.869
Length: 107.
Predicted Ligands:
SAM - 12/20
glycine - 4/20
guanidine - 2/20
 RS: URS0000AB1902_1262954
MFE: -30.481
Ligand: SAM
Species: Ruminococcus sp. CAG:330 SAM riboswitch (S box leader)
 RS: URS0000C4477B_1262449
MFE: -20.806
Ligand: SAM
Species: Clostridium pasteurianum DSM 525 = ATCC 6013 SAM riboswitch (S box leader)
 RS: URS000042C1B1_717785
MFE: -38.820
Ligand: guanidine
Species: Hyphomicrobium sp. MC1 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092482 URS0000AB1902_1262954 URS0000C4477B_1262449 URS000042C1B1_717785
Length 107. 107. 107. 108.
Similarity - 0.974 0.972 0.971
Ensemble Norm 0.869 - - -
MFE -32.382 -30.481 -20.806 -38.820
Ligands - SAM SAM guanidine
Gene RPL26L1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 16.001 10.
Length SE - 0. 0. 1.
Lev Distance - 31. 30. 33.
UBS 10. 10. 9. 11.
BS 0. 0. 0. 0.
ILL 5. 6. 4. 3.
ILR 2. 4. 3. 2.
H 1. 1. 1. 2.
BL 1. 2. 3. 3.
BR 7. 5. 4. 7.
UN 0.009 0.019 0.037 0.019

Sequences

Field Description
UTR seq + 25 ggcgaacgaaacgcggagcucgggagcgacccggcggggccaggcacgggcagaagggccaagagggccacagagggucaccATGAAGTTCAATCCCTTCGTTACCT
UTR dot + 25 ((..((((((…..(((((((((…(((((..(.(((((…….(((……)))…..)))).).).))))).)).))).))))……)))))).)).
RS 1 seq ACCUUAUCAAGAGCGGCGGAGGAACAGGUCCUGUGAAGCCCGACAACCGGCUGAUUGCAAGCGUCAGCAGCGGUGCCAAAUCCUGCGGUAUAUCCGAAAGAUGAGGG
RS 1 dot .(((((((…..(((((.((((…(((.((((…((..(((..(..((…..))..).))).)).)))).)))…)))).))……)))…))))))).
RS 2 seq AGCUUAUCAAGAGAGGUAGAGGGACUGGCCCGUUGAAACCCGACAACCAGCAUUAUUGUUAGUAUGCAUGGUGUUAAUUCCAGCAGAUUGUUUCUGAGAGAUAAGGA
RS 2 dot ..((((((…((((((((…(.((((…(((((.(((…((((.((((….)))).)).))…))).))))).)))))…))))))))….))))))..
RS 3 seq GCAUAACGCCUCUAGGGUUCCGGCUUUCCCAAGCGUCAGGUCCGAGAGAGGCUCUCCCGCCUCGCGAGCAGCGCGGCGGAGCCACGGCGGGAUAAAAGCCCGGGAGAC
RS 3 dot ((…..))((((.(((((((.((((((((..((((…((.((…(((((……))))).)).)).)))).).))))….))).)))…..)))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table