Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092485 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA092485
Gene: RPL26L1_1
MFE: -23.866
ENS: 0.943
Length: 73.
Predicted Ligands:
fluoride - 8/20
cobalamin - 5/20
SAM - 2/20
 RS: URS0000D9A6DE_987057
MFE: -21.332
Ligand: fluoride
Species: Burkholderia sp. TJI49 Fluoride riboswitch
 RS: URS0000DA275D_1798253
MFE: -15.935
Ligand: SAM
Species: Gallionellales bacterium RIFCSPLOWO2_02_60_31 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C595A0_1295626
MFE: -27.983
Ligand: fluoride
Species: Cellulomonas sp. B6 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092485 URS0000D9A6DE_987057 URS0000DA275D_1798253 URS0000C595A0_1295626
Length 73. 71. 75. 73.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.943 - - -
MFE -23.866 -21.332 -15.935 -27.983
Ligands - fluoride SAM fluoride
Gene RPL26L1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 6.010 8.002
Length SE - 4. 4. 0.
Lev Distance - 18. 18. 23.
UBS 3. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 0. 1. 2.
BR 0. 1. 0. 1.
UN 0.178 0.155 0.280 0.137

Sequences

Field Description
UTR seq + 25 ggcccugcgcacucagggucugaggcagcuaguagccggagggucaccATGAAGTTCAATCCCTTCGTTACCT
UTR dot + 25 (((((((……)))))))………..((((.(((((((……………..)))))))))))..
RS 1 seq GUCGUUACGGGAGAUGGCAUACCUCCACGAACCGCCGCCCGACCGGUGCGGCUGAUGAUGCCUACGGUUCC
RS 1 dot ((((((……))))))……….((((((((((((….)).)))))………….))))).
RS 2 seq CUGCACAUCAGUGCCGAUUUGACAUCAGCUUGCGGGGCACUUUAAACAUACCAGCUAAAGCGAGGCAACCCGCUC
RS 2 dot ..((((….))))……………..(((((((.(((………..((….)))))))..)))))..
RS 3 seq GCUGGUCGCGGCGAUGGAUCCCGCCGGGGCGUGACGCCCGAACCGCCGCACGGCUGAUGGUUCCUGCUCCGGU
RS 3 dot ((((….))))……….(((((((((.((.(((……(((….)))….))))).)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table