Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092526 Similarity: 0.966 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA092526
Gene: RPL29
MFE: -57.947
ENS: 0.838
Length: 138.
Predicted Ligands:
cobalamin - 8/20
FMN - 7/20
homocysteine - 2/20
 RS: URS0000C4EA48_242163
MFE: -48.583
Ligand: homocysteine
Species: Candidatus Burkholderia verschuerenii S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB2AD4_997346
MFE: -52.280
Ligand: FMN
Species: Desmospora sp. 8437 FMN riboswitch (RFN element)
 RS: URS0000450568_224308
MFE: -35.319
Ligand: SAM
Species: Bacillus subtilis subsp. subtilis str. 168 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092526 URS0000C4EA48_242163 URS0000AB2AD4_997346 URS0000450568_224308
Length 138. 138. 138. 139.
Similarity - 0.966 0.964 0.963
Ensemble Norm 0.838 - - -
MFE -57.947 -48.583 -52.280 -35.319
Ligands - homocysteine FMN SAM
Gene RPL29 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 2.001 4.007
Length SE - 0. 0. 1.
Lev Distance - 41. 47. 46.
UBS 12. 11. 13. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 2.
ILR 2. 1. 2. 3.
H 2. 3. 2. 2.
BL 5. 4. 5. 6.
BR 5. 3. 6. 5.
UN 0.007 0.029 0.043 0.094

Sequences

Field Description
UTR seq + 25 cgcgcggcauccgaugccauccgcgacuuacggguggcggcggggcgcgggcugcggagaggacuggugaccgaccgugugucugucgggagcaaaagcugcggggugcagacATGGCCAAGTCCAAGAACCACACCA
UTR dot + 25 (((((….((((.(((((((((…….))))))))).)))))))))((.((.((…((((((((………((((((((((.(.(((….))).).)…))))))))))))).))))…..)).)))).
RS 1 seq GUUUCCGAGGAGCGUUGCGACGGGCAAUCUGAAAGCCGCCCGCCAGGCUCGGAGACAUUCAAUCCGGACGGUUCGAACGCGCUUUUAGUUAUGAAAGGCGCUCGCUGAGCCACCGCAUUCGAACGGCGCUCACGUCAA
RS 1 dot ((((((…((((.(((.(.(((((…………))))))))))))))))))).((((((.(((..((((((…((((((((…….))))))))….)))))).))).))).))).((((….))))..
RS 2 seq UGCAUCCUUCGGGGCGGGGUGAAAUUCCCGACCGGCGGUGAUGGAGGGGCAUCCCUCCUCAGUCCGUGACCCGCGUUUGCGGUGGAUCCGGUGAAACUCCGGGGCCGACAGUUAAAGUCUGGAUGGGAGAAGGAUGAA
RS 2 dot (.((((((.(.((.(((((……))))).)).).)).)))).)….((((((((((..(((((.(((……(((((((…(((((…….))))))))).)))…..)))))))))))))..)))))..
RS 3 seq CUCUUAUCCCGAGCUGGCGGAGGGACAGGCCCUAUGAAGCCCAGCAACCGGUUUCUCUGUUAUUUAUUAUGUUCAACUGAGUGAGACAACCAAGGUGCUAACCUGUUGCAAGGUUGUAUGAUUCCUUGAGCGAUAAGAG
RS 3 dot ……..(((.(((((((.((((…..)))).))….)))))…)))…..((.(((((……((((((..((((.(.((((((.((((….))))…….)))))).).)))).))))))))))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table