Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092527 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA092527
Gene: RPL29_0
MFE: -35.322
ENS: 0.913
Length: 95.
Predicted Ligands:
TPP - 12/20
Mn2+ - 3/20
preQ_1 - 2/20
RS: URS0000D98D64_1703345
MFE: -26.229
Ligand: TPP
Species: Niastella vici TPP riboswitch (THI element)
RS: URS0000BEF082_1324352
MFE: -24.411
Ligand: TPP
Species: Chryseobacterium gallinarum TPP riboswitch (THI element)
RS: URS0000BFCDB5_755172
MFE: -19.287
Ligand: TPP
Species: Peptoniphilus sp. RMA 16757 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092527 URS0000D98D64_1703345 URS0000BEF082_1324352 URS0000BFCDB5_755172
Length 95. 95. 96. 96.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.913 - - -
MFE -35.322 -26.229 -24.411 -19.287
Ligands - TPP TPP TPP
Gene RPL29 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.022 1.001 8.005
Length SE - 0. 1. 1.
Lev Distance - 25. 26. 24.
UBS 6. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 0. 1. 0. 1.
H 3. 2. 3. 3.
BL 1. 1. 2. 0.
BR 2. 1. 2. 0.
UN 0.211 0.063 0.188 0.281

Sequences

Field Description
UTR seq + 25 ugccauccgcgacuuacggguggcggcggggcgcgggcugcggagaggacuggugaccgaccgugcagacATGGCCAAGTCCAAGAACCACACCA
UTR dot + 25 .((((((((…….))))))))..((.(((….))).))….(((((((…….(((((….)))))))).))))………….
RS 1 seq ACGGCACUUUAGGGGUGUCCAUUAAGCGGACUGAGAUAAUACCCUUUGAACCUGAUGCAGUUCGUACUGCCGAAGGGAAAAGUGAAAGUCUUCUU
RS 1 dot ..(((((((…)))))))….(((.(((((………(((((((……..(((((….))))))))))))………))))).)))
RS 2 seq CCCAUACUUUAGGGGUGUCUGUGUUUACAGACUGAGACUUUACCCUUUGAACCUGAUCUGGAUCAUACCAGCGUAGGGAAAAGUAGAUGACUUUGC
RS 2 dot (((……..)))..((((((….))))))….(((((.((((.((……..((((……)))))).)))).)))))…………
RS 3 seq AAUAAUUGCAAGGGGGACUUUGACGUUGAGAAGGUAGAACCUGACCCUAUGAACCUGUGAGUUAAUACUCGCGUAGGAAUGCAUGCGACUUUUUAU
RS 3 dot ..((((..(((((….)))))..))))…((((…))))…(((((……((((((….)))))))))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table