Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092595 Similarity: 0.978 Similarity: 0.977 Similarity: 0.974
UTR: 5HSAA092595
Gene: RPL36A
MFE: -26.149
ENS: 0.971
Length: 109.
Predicted Ligands:
SAM - 13/20
glycine - 3/20
TPP - 2/20
 RS: URS0002320BE1_122586
MFE: -27.639
Ligand: SAM
Species: Neisseria meningitidis MC58 SAM-I/IV variant riboswitch
 RS: URS0000C4285D_1293054
MFE: -24.979
Ligand: SAM
Species: Halanaerobium saccharolyticum subsp. saccharolyticum DSM 6643 SAM riboswitch (S box leader)
 RS: URS0000C6AB12_1618732
MFE: -24.281
Ligand: SAM
Species: Candidatus Nomurabacteria bacterium GW2011_GWA1_46_11 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092595 URS0002320BE1_122586 URS0000C4285D_1293054 URS0000C6AB12_1618732
Length 109. 110. 109. 108.
Similarity - 0.978 0.977 0.974
Ensemble Norm 0.971 - - -
MFE -26.149 -27.639 -24.979 -24.281
Ligands - SAM SAM SAM
Gene RPL36A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 8. 5.004
Length SE - 1. 0. 1.
Lev Distance - 28. 28. 32.
UBS 7. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 0. 0. 1. 1.
H 4. 4. 3. 3.
BL 1. 1. 3. 2.
BR 2. 3. 2. 2.
UN 0.211 0.245 0.229 0.148

Sequences

Field Description
UTR seq + 25 gaggaagugcgaucgggaaccuccuauauacuuccguuugccucgcgguuucuuucuuuccgcgccgauagcgcucacgcaagcATGATTGCTCCTACCGACTCCCATG
UTR dot + 25 ..(((((((..((.((((…)))))).)))))))..(((…(((((………..))))).)))..(((….))).((((….))))…………….
RS 1 seq GUGCUGCAUUAAGAGUUGGGAAUUCCAUGCCAACCUGCUUUUCAAAAGGAAAAGUAAGGUGGACGGUUGAAAAGCCGAUGUGGCUCACCAGAGCAAUCCAAACCCGCUUG
RS 1 dot …..((((…(((((…))))).))))(.(((((((((((…..)))))))).))).).(((((….)))))…..((((….))))…………….
RS 2 seq AAAUCAUCAAGAGCGGUGGAGGGACUGGCCCUGUGAUACCCGGCAACCUACUUAAAAUCUUUAGUAAGGUGCUAAUUCCAGCAUUCCGGAAAGGAAUGAUAGAUGAGAG
RS 2 dot ..((((.((.(..((((……))))..).))))))….(((.(((((((……….)))).))))))……..((((((…..))))))………..
RS 3 seq AAGUUAUUAAGAGUAUGGUGAGAGCACUGGCUCAAUGACCCAUCAGCAACCUAUCAGGUGGAUAAAUGACAAGGUGCUAAUUCCAGCCCGUAAAGGGAGAAAUAAUAC
RS 3 dot ..((((((..((((..((((….)))).))))))))))…..(((.((((.(((……….)))..)))))))..(((…(((…..))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table