Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092598 Similarity: 0.972 Similarity: 0.971 Similarity: 0.969
UTR: 5HSAA092598
Gene: RPL36AL
MFE: -33.167
ENS: 0.892
Length: 131.
Predicted Ligands:
cobalamin - 13/20
FMN - 5/20
GMP - 1/20
 RS: URS0002319162_743525
MFE: -59.878
Ligand: cobalamin
Species: Thermus scotoductus SA-01 Cobalamin riboswitch
 RS: URS0000D6CAE6_12908
MFE: -59.588
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C12DCE_1105031
MFE: -43.246
Ligand: FMN
Species: Clostridium sp. MSTE9 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092598 URS0002319162_743525 URS0000D6CAE6_12908 URS0000C12DCE_1105031
Length 131. 131. 131. 131.
Similarity - 0.972 0.971 0.969
Ensemble Norm 0.892 - - -
MFE -33.167 -59.878 -59.588 -43.246
Ligands - cobalamin GMP FMN
Gene RPL36AL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.007 3.001 13.001
Length SE - 0. 0. 0.
Lev Distance - 34. 38. 35.
UBS 12. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 5. 3. 5. 4.
ILR 4. 4. 3. 1.
H 2. 2. 2. 2.
BL 3. 3. 4. 4.
BR 3. 3. 3. 2.
UN 0.015 0.099 0.038 0.038

Sequences

Field Description
UTR seq + 25 ccuuuccuguuaggcgagagcugcgaaaggcgagagcugcgaagggccaggugucgggcgcuguuucucguuuucaucauauagacaaaacagcccugcugcaaagATGGTCAACGTACCTAAAACCCGAA
UTR dot + 25 ((((((..((..(((….)))))))))))((.(((.((((…(((((..(((((((.(((((((…((((………)))).)))))))))))..)))….)))))..)))).))….).))..
RS 1 seq CGCGAUGCCAGGCCGACAGGCCUGGACGCCAGCCGGCGGUGGGGGAAGUCCGGUGAAAGUCCGGCGCUGUCCCGCAACGGUAACCGGCUUUGUCCGGAAGCCCGAGUACCCGCUUCGCGGCCUUACCCCGU
RS 1 dot .(((…(((((((….))))))).)))..(((((.((((((((…(((((..((((.((((.(((((……)))))..))))))))..)))))…))…..)))))).).))))……….
RS 2 seq ACGCACCACGGAUGCGUUGAUCCUCGGGCACCAGCAGCACGGUCGCCCGUCGCGUCGCAGGGGCUCCUUCAGGGGCACUCCUCCGCGCGAUGGCCUGAGGGGAGCGAGUGGCGAGACCGGCCGUGAGCUGA
RS 2 dot ..((.((..((((……))))..))))..((((..((((((((…(((.((((((….(((((((..(((.((.((……..)))).)))..)))))))..)))))).))))))))))).)))).
RS 3 seq AGCUGUCUUCGGGGCGGGGUGUGAUUCCCCACCGGCGGUAAUGCGGUUUUUGGCCGUUAGCCCGCGAGCAUGUGCUGAUUUUGGUGAGAUUCCAAAGCCGACGGUAUAGUCCGGAUGGAAGAAGAACUGCG
RS 3 dot .((((((…..((.((((…….)))).))))))))…(((((((((..((((….(((.((.(.(((((((…(((((………..))))))))))))))))))))))..))))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table