Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092843 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA092843
Gene: RPS10
MFE: -23.063
ENS: 0.986
Length: 90.
Predicted Ligands:
TPP - 12/20
cobalamin - 2/20
glycine - 2/20
 RS: URS0000C308A5_1618204
MFE: -35.764
Ligand: TPP
Species: Puniceibacterium sp. IMCC21224 TPP riboswitch (THI element)
 RS: URS0000DA2AAC_734
MFE: -18.625
Ligand: TPP
Species: Haemophilus paracuniculus TPP riboswitch (THI element)
 RS: URS000078BE77_1461584
MFE: -22.730
Ligand: TPP
Species: Arthrobacter saudimassiliensis TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092843 URS0000C308A5_1618204 URS0000DA2AAC_734 URS000078BE77_1461584
Length 90. 91. 89. 90.
Similarity - 0.982 0.981 0.980
Ensemble Norm 0.986 - - -
MFE -23.063 -35.764 -18.625 -22.730
Ligands - TPP TPP TPP
Gene RPS10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 6. 3.
Length SE - 1. 1. 0.
Lev Distance - 23. 22. 26.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 2. 2. 4. 2.
H 2. 2. 2. 2.
BL 2. 2. 3. 3.
BR 3. 2. 2. 3.
UN 0.078 0.132 0.067 0.089

Sequences

Field Description
UTR seq + 25 acagccgcgagauuccgcgcuggguacggucgcugauggccuccaacugcucccgauaauacaggATGTTGATGCCTAAGAAGAACCGGA
UTR dot + 25 .(((.((((……)))))))….(((((……(((…((((…(((.(……).))).))))..)))……)).)))..
RS 1 seq CGCGAUCCGUCGGGGUGCCUCUUGGGGCUGAGAAUAACCCGUCGAACCUGAUCCGGGCAAUACCGGCGUAGGGAACGGGUAUCUGGGCGAU
RS 1 dot .((.((((….))))))……..(((.(((…((((((….((((..((((……))))..))))..)))))).))).)))…
RS 2 seq CCGUUCUCAUUGGGGUGCGUUUUGCUGAGAAAUACCCAUAGAACCUGAUCUGAGUAAUAUCAGCGUAGGGAUUUGAGACUGCCUUUCAG
RS 2 dot .(((.(((….))).)))…..((((((..((..(.((((.((((..((((……))))..))))..)))).)..))..))))))
RS 3 seq GGCAGUGACACGGGGUGCCGCAAGGCUGAGAUGAGACCCGUCGAACCUGAUCUAGUUAGAACUAGCGAAGGGAUGUCGCGGAUGAGCAUU
RS 3 dot ((((.(…….).))))…..(((.(..((.(((..(((…(((…(((((….)))))…))))))))).))..).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table