Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092848 Similarity: 0.979 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA092848
Gene: RPS12
MFE: -37.185
ENS: 0.944
Length: 107.
Predicted Ligands:
SAM - 18/20
TPP - 1/20
glycine - 1/20
 RS: URS0000C72775_747377
MFE: -22.799
Ligand: SAM
Species: Clostridium sp. DMHC 10 SAM riboswitch (S box leader)
 RS: URS0000D97968_1685010
MFE: -25.323
Ligand: SAM
Species: Chryseobacterium glaciei SAM riboswitch (S box leader)
 RS: URS0000C2F9B7_1236550
MFE: -36.714
Ligand: SAM
Species: Kocuria palustris PEL SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092848 URS0000C72775_747377 URS0000D97968_1685010 URS0000C2F9B7_1236550
Length 107. 107. 107. 107.
Similarity - 0.979 0.979 0.978
Ensemble Norm 0.944 - - -
MFE -37.185 -22.799 -25.323 -36.714
Ligands - SAM SAM SAM
Gene RPS12 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 7.003 6.003
Length SE - 0. 0. 0.
Lev Distance - 27. 26. 27.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 2. 2. 2. 2.
H 3. 3. 3. 4.
BL 2. 3. 3. 2.
BR 3. 2. 1. 1.
UN 0.206 0.262 0.262 0.150

Sequences

Field Description
UTR seq + 25 cucuuucccugccgccgccgagucgcgcggaggcggaggcuugggugcguucaagauucaacuucacccguaacccaccgccATGGCCGAGGAAGGCATTGCTGCTG
UTR dot + 25 ……..(((((.((((((…)).)))).))))).(((.((((((((…(((……)))….)))).))))..)))…(((……)))……….
RS 1 seq ACCUUAUUAAGAGAGAUGGAGGGACUGGCCCGAUGAAAUCUCAGCAACCAAUAUGUCACAUUUGCAUAUAUGGUGCUAAUUCCACAGACUAUUCUGAAAGAUAAGGA
RS 1 dot ……….((((..(.(.(((…..)))..).)..))))(((.((((((((((…….)))))).)))))))…….((((….))))………..
RS 2 seq GAUUUAUCAAGAAAGGUGGAGGGAUUUGGCCCUGUGAAACCUUAGCAACCGACACAAUUCCAGCGUGUAAAGGUGCUAAUUCCAACCCGAUUGAGGGUAGAUAAGUG
RS 2 dot …………..((((.((((……)))).)…)))(((((.(((.((((………))))…))))))))…..((((……))))………
RS 3 seq UUCCCAUCCGGAGCGGCCGAGAGACCUGGCUCGUCGACGCCGCAGCAACCAGUGCCGUCCAUCCGCGGCACAAGGUGCUAAUGCCAGGACCGAUGGAGUGAUGUGAU
RS 3 dot .(((…..)))(((((((((((……))).)))..)))))(((.(((.(((((((……)))))))..))))))….(((…….)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table