Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092865 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA092865
Gene: RPS14
MFE: -17.490
ENS: 0.975
Length: 108.
Predicted Ligands:
TPP - 10/20
guanidine - 5/20
glycine - 2/20
 RS: URS0000D842F8_1897048
MFE: -29.706
Ligand: TPP
Species: Clostridiales bacterium 52_15 TPP riboswitch (THI element)
 RS: URS0000BEDCF0_1403540
MFE: -35.251
Ligand: TPP
Species: Halomonas sp. BC04 TPP riboswitch (THI element)
 RS: URS0000DAC677_1945858
MFE: -37.117
Ligand: glycine
Species: Rhodanobacter sp. C03 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092865 URS0000D842F8_1897048 URS0000BEDCF0_1403540 URS0000DAC677_1945858
Length 108. 108. 109. 107.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.975 - - -
MFE -17.490 -29.706 -35.251 -37.117
Ligands - TPP TPP glycine
Gene RPS14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 10.007 3.008
Length SE - 0. 1. 1.
Lev Distance - 33. 30. 33.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 0. 1. 1. 1.
H 4. 4. 4. 4.
BL 2. 2. 0. 3.
BR 2. 1. 1. 2.
UN 0.259 0.231 0.174 0.168

Sequences

Field Description
UTR seq + 25 guuaacgcacugggucgugcucauuggucugauuugaagauaggaacauuuaacuucguacacccaagacuuacacuugaaaaATGGCACCTCGAAAGGGGAAGGAAA
UTR dot + 25 ……((((……))))…..(((.((…(((((.(((……))).))))))).)))((((…….))))……….((((….))))…….
RS 1 seq AAAUAAUAAACGGGGUGCUCGUAUACGGGCUGAGAGGAAGGUGUGACCCUCGACCCGAAUAACCUGAUUUGGAUAAUGCCAACGUAGGGAACGGAAAUAUCCGGGUAU
RS 1 dot ………(((((…)))))…((((.((((.((………)))))).))))…..((((..((((……))))..))))…((((….))))…..
RS 2 seq GAACGCUUGACGGGGUGCCGUUACCGACGGCUGAGAUCAUGUGCCCAAGCAUGGAUCCCGUUGAACCUGAACUGGCUAGGACCAGCGUAGGAUCAAGCGACACGCAGAG
RS 2 dot …….((((((….)))))).((((((….((((..((((….)))).))))))))))..((((..((((……))))..))))…..(((…)))….
RS 3 seq CGUAAACACUCUGGAGAGAGCGGCUGCCUUCAUCGGCGCAAGCCGCCGCCGAAGGGGCACGAGGCUUUCGCCUCCAAACUCUCAGGCAAAAGGACAGAGGGGCGCCC
RS 3 dot ……(.((((….)))).)(((.(((((..(((((…..)))))..))))))))..(((((….)))))….(((((.(………).)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table