Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092872 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA092872
Gene: RPS15
MFE: -25.647
ENS: 0.736
Length: 87.
Predicted Ligands:
zmp-ztp - 11/20
cobalamin - 3/20
GMP - 2/20
 RS: URS0000C86E9D_1751294
MFE: -36.166
Ligand: zmp-ztp
Species: Streptomyces sp. 4F ZMP/ZTP riboswitch
 RS: URS0000D6600A_12908
MFE: -38.937
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C5D804_1300344
MFE: -42.179
Ligand: zmp-ztp
Species: Isoptericola dokdonensis DS-3 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092872 URS0000C86E9D_1751294 URS0000D6600A_12908 URS0000C5D804_1300344
Length 87. 86. 86. 87.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.736 - - -
MFE -25.647 -36.166 -38.937 -42.179
Ligands - zmp-ztp GMP zmp-ztp
Gene RPS15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 4.001 7.001
Length SE - 1. 1. 0.
Lev Distance - 20. 21. 21.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 3. 1. 3. 1.
H 2. 2. 2. 2.
BL 3. 3. 2. 3.
BR 3. 3. 2. 4.
UN 0.046 0.047 0.012 0.023

Sequences

Field Description
UTR seq + 25 ggcagucucgcgauaacugcgcaggcgcggaccaaagcgaucucuucugaggauccggcaagATGTTGGGGCGAGGGGCGGACTTGG
UTR dot + 25 .((.((((((((…..)))).))))))…((((..(..((((((((.((.(((……))).)).))..))))))..)..))))
RS 1 seq CGCCUGGGCCGUGACUGGCGCUGAGGUGGAGCACCACCGGGGAGCGGUCUGACGAGACGUCGUUGCCGUGCGCCUGGGCCAAUGGU
RS 1 dot (((((.((.(((…..))))).)))))….((((((((((.(((((..(((((….)))))))))).).)))))…..))))
RS 2 seq UCGUUCUCGGAAGGCGUCGACGCGCGGCCUAUGAAGCGUGCCGCCGGGACCGCGCCGAGCUACUGGCGAGACCGGUCCGAGGGGCA
RS 2 dot .((((.(((..((((..((…))..)))).)))))))((((.(..(((((((((((……)))))….))))))..).))))
RS 3 seq UCGCCGUGUCGCGACUGGCGUACAGGUGGAUCACCACCGGGGAGCGACGCGCUGUGUGACGACGGGUCGUUCGCCUGGGCCUGGUCC
RS 3 dot .((((.((((((…..))).)))))))(((((…((((((((((((.((.(((…))).)).))))))).)))))…))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table