Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092933 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA092933
Gene: RPS2
MFE: -12.479
ENS: 0.873
Length: 48.
Predicted Ligands:
SAM - 7/20
preQ_1 - 5/20
glutamine - 5/20
 RS: URS0000E6098E_150033
MFE: -9.981
Ligand: unknown
Species: Enterococcus ratti DUF1646 RNA
 RS: URS00021EDD40_12908
MFE: -10.392
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000D905FD_1078083
MFE: -5.009
Ligand: preQ_1
Species: Staphylococcus sp. HGB0015 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092933 URS0000E6098E_150033 URS00021EDD40_12908 URS0000D905FD_1078083
Length 48. 48. 47. 48.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.873 - - -
MFE -12.479 -9.981 -10.392 -5.009
Ligands - unknown SAM preQ_1
Gene RPS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 3. 6.
Length SE - 0. 1. 0.
Lev Distance - 16. 15. 16.
UBS 4. 3. 3. 2.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 1. 1. 2. 1.
H 1. 1. 1. 1.
BL 1. 1. 0. 0.
BR 0. 1. 0. 0.
UN 0.167 0.250 0.170 0.146

Sequences

Field Description
UTR seq + 25 cuucuuuuccgacaaaacaccaaATGGCGGATGACGCCGGTGCAGCGG
UTR dot + 25 ……..(((.(….((((….((((…..))))))))..))))
RS 1 seq GGUUGGGCUUAUGCUUCAAGGAUUGCGUUCUUCAAGGGGUGAGAAGAA
RS 1 dot …….(((((.(((..((((……))))..))).)))))…..
RS 2 seq AUUGCACGCAACGGCUUCCUGACGCGUGAGUGUUAAUUAUCGGAGCA
RS 2 dot …….((..(((…..((((((….))))))….)))..)).
RS 3 seq AUUAAAGAGGUUCCUAGCUUCCAACCCUCUAUAAAAAACUAGACACCU
RS 3 dot …….((((..((((…………………))))..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table