Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092937 Similarity: 0.965 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA092937
Gene: RPS20
MFE: -49.002
ENS: 0.895
Length: 152.
Predicted Ligands:
FMN - 9/20
TPP - 3/20
cobalamin - 3/20
 RS: URS0000BEAB77_1304275
MFE: -58.459
Ligand: TPP
Species: Salinisphaera hydrothermalis C41B8 TPP riboswitch (THI element)
 RS: URS0002330963_1801946
MFE: -36.922
Ligand: cobalamin
Species: Planctomycetes bacterium RIFCSPLOWO2_12_38_17 Cobalamin riboswitch
 RS: URS0000DA2B67_1802306
MFE: -29.339
Ligand: cobalamin
Species: Candidatus Taylorbacteria bacterium RIFCSPHIGHO2_02_FULL_43_32b AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092937 URS0000BEAB77_1304275 URS0002330963_1801946 URS0000DA2B67_1802306
Length 152. 153. 152. 152.
Similarity - 0.965 0.961 0.960
Ensemble Norm 0.895 - - -
MFE -49.002 -58.459 -36.922 -29.339
Ligands - TPP cobalamin cobalamin
Gene RPS20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3. 7.005
Length SE - 1. 0. 0.
Lev Distance - 43. 52. 51.
UBS 10. 12. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 3. 2. 3. 4.
H 4. 4. 4. 4.
BL 3. 4. 2. 1.
BR 2. 3. 1. 1.
UN 0.138 0.124 0.145 0.211

Sequences

Field Description
UTR seq + 25 cuuucuuuuugaggaagacgcggucguaagggcugaggauuuuugguccgcacgcuccugcuccugacucaccgcuguucgcucucgccgaggaacaagucggucaggaagcccgcgcgcaacagccATGGCTTTTAAGGATACCGGAAAAA
UTR dot + 25 (((((((…)))))))..((((.(((..((((((((….))))))))..)))…)))).(((((((.((…(((((.(((…..)))))))).)).)))))))(((((…((……))…)))))………………
RS 1 seq CCGGUGUCCAAGGGGAGCCAAACGGCUGAGAGGUCCGCACAAAGCGGACGACCCUGGGGCCUGCGUUUCGCGACACUGCUCGCCAUCGACGAGUUGCAGGCCCUCGUACCUGAUCCGGUUAGUACCGGCGUAGGAAUGGCCAUGAAACAUUUG
RS 1 dot ..(((.(((….))))))…(((..(.(..((((((…..))))))..)))))(((((((((.(((((((…………))).)))).)))))))))((((.((((..(((((….)))))..)))).))))…………..
RS 2 seq GGGAAUCCCGUAGAGACGGGAGCUGCCCCGCAACUGUAAUCGGCGACGAAAUCUGCAAUAUGCCACUAUUUCAAAAUUUGAUUUGAGAUGGGAAGACGCAGAGAGUAGGAAGACCCGGAAGCCAGGAAACCUAUUUGAACAUUAUUUUUAUG
RS 2 dot (((..((((((….))))))….)))(((………..)))……(((((…….(.((((((((((……)))))))))))…..)))))(((((((….((.((…)).))…)))))))…………….
RS 3 seq UGAGCAUAGAAUAAGUUUGUUGCUUGUGGAAGUAGGGUUCAAUUCCCUCACUGUGCCGCAACGGUAAAUGUCGUCUCUUUGGCGAUUUAGUCCGGUCUUCAAGUGAUAAGUUCUAAUCAACGAAUCCAUACGAAUCUUAGCGAAUAGUUUUA
RS 3 dot .(((((..(((….)))..)))))((((.(((((((…….)))).)))…))))..(((…..((((((…..))))))…..)))……..(((….((((……..))))…)))…………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table