Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092945 Similarity: 0.981 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA092945
Gene: RPS24
MFE: -22.420
ENS: 0.960
Length: 111.
Predicted Ligands:
TPP - 11/20
methionine - 4/20
zmp-ztp - 2/20
 RS: URS0000BE4100_1408890
MFE: -37.669
Ligand: TPP
Species: Rhodobacter sp. CACIA14H1 TPP riboswitch (THI element)
 RS: URS000074B371_258533
MFE: -45.282
Ligand: TPP
Species: Mycobacterium cosmeticum TPP riboswitch (THI element)
 RS: URS0000AB396A_196164
MFE: -29.199
Ligand: TPP
Species: Corynebacterium efficiens YS-314 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092945 URS0000BE4100_1408890 URS000074B371_258533 URS0000AB396A_196164
Length 111. 112. 112. 110.
Similarity - 0.981 0.976 0.975
Ensemble Norm 0.960 - - -
MFE -22.420 -37.669 -45.282 -29.199
Ligands - TPP TPP TPP
Gene RPS24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 3.005 11.001
Length SE - 1. 1. 1.
Lev Distance - 23. 30. 26.
UBS 11. 11. 12. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 3. 3. 4. 3.
H 1. 2. 1. 1.
BL 6. 5. 6. 6.
BR 6. 6. 6. 3.
UN 0.126 0.036 0.054 0.155

Sequences

Field Description
UTR seq + 25 gggguccuuccgugcgcguugauaugauuggccggcgaaucgugguucucuuuuccuccuuggcugucugaagauagaucgccaucATGAACGACACCGTAACTATCCGCA
UTR dot + 25 .(((((.(((.(((.(((….(((..((((.((((.((..(.((………)).).)).)))).))))..)))…))))))…))).))).))………….
RS 1 seq CGCCUUACCUCGGGGUGCCCGCCGGACCUGGUCCGACUGGCUGAGAUGCGAAAGCGGACCCGUUGAACCUGAACCGGAUCAUACCGGCGGAGGGAAGGUGCAUGGAAUUCCU
RS 1 dot ((((((.((((.(((((….((((..(.(((.((((.(((((………..))).)).)))).))).)..))))….))))..).)))).))))))…((….)).
RS 2 seq GACACCCGACGCGGGAGUCCCGGGACCGGGGCUGAGAGUGGGCCAAUCACCGGCCCUGACCGUUGCACCUGAUCCGGGUCAUGCCGGCGAAGGGAGAGGGAAUGUCUGAGCG
RS 2 dot (((((((..(((.((.(.((((((..((((((.(.(.(((((((…….)))))..))).).)).)))).)))))).)…)).)))..)))……..))))……
RS 3 seq UCGAUAUUGCACGGGUGUCCGGUGAAAGUCCGGGCUGAGAGGUGGCACAGCCACAACCGUUGAACCUGAUCCGGGUAAUGCCGGCGAUAGGGAGGAAACAUGACUGAUAC
RS 3 dot ((..((((((.(((.(((((((…..((.((((.(.((.((((((…)))…))).)).).)))))))))))))…)))))))))..))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table