Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092962 Similarity: 0.966 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA092962
Gene: RPS24_0
MFE: -31.809
ENS: 0.996
Length: 142.
Predicted Ligands:
cobalamin - 16/20
FMN - 2/20
TPP - 1/20
 RS: URS0002333136_512402
MFE: -49.352
Ligand: cobalamin
Species: Mycobacterium sp. NCTC 13432 Cobalamin riboswitch
 RS: URS0002331B6F_146020
MFE: -51.522
Ligand: cobalamin
Species: Mycobacterium brisbanense Cobalamin riboswitch
 RS: URS0000ABCEFB_12908
MFE: -23.371
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092962 URS0002333136_512402 URS0002331B6F_146020 URS0000ABCEFB_12908
Length 142. 142. 142. 141.
Similarity - 0.966 0.964 0.964
Ensemble Norm 0.996 - - -
MFE -31.809 -49.352 -51.522 -23.371
Ligands - cobalamin cobalamin cobalamin
Gene RPS24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 7.001 5.011
Length SE - 0. 0. 1.
Lev Distance - 40. 44. 44.
UBS 14. 15. 13. 12.
BS 0. 0. 0. 0.
ILL 4. 6. 4. 4.
ILR 4. 3. 6. 4.
H 2. 2. 2. 2.
BL 5. 5. 4. 5.
BR 4. 6. 3. 3.
UN 0.021 0.063 0.049 0.128

Sequences

Field Description
UTR seq + 25 uggugagucucccugggcccgugcagucaucugccgcguauccgagccauccguggucccugggucccaguacuugagcuauagaacgacaccguaacuauccgcacuagaaaguucATGAACGACACCGTAACTATCCGCA
UTR dot + 25 .((((.(.(((…(((..(((((((….)))).)))..))))))))))).((((….((((((…((.(.((((((((((.(((….)))..))))………..)))))).).))))).)))…….)))).
RS 1 seq AGGCGCCGGGCGUGCGACAAUUCGCCGGUAAGGCGAUGACGAUGUAGGAAGCCGGUGCGAAUCCGGAGCGGUCCCGCCACUGUCAUCGGGGGAGUGAACUCACCCGAGAGCCAGACACUCACGUCGUCGCAACCUCCGAUUC
RS 1 dot .(((.((..((((.((.((..(((((…..))))))).)))))).))..)))(((((((…(((((..(((..((…..((.(((((.(((….))).)))))))))..))).))).))…))))).))……..
RS 2 seq GUCCGCUGACCUACCAUCGAUACCGAUAGGCGACUGCGGAUCGUGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGAUCGGUUUCAGCGUGCGCUGAUCCCGAGAGCCAGAUACGCACCGCAGUCACCACCUCACA
RS 2 dot ((((((((.((((…(((….)))))))))…)))))).((((..(((((((((.(((.(((.(((….(((((..(((……)))..))).))…..)))…))).))).)))))))..))..))))……
RS 3 seq GUACUGAAGUUUAGGUGGGGAACAAUGUGCAAAUCAUUGACUAUCCCUGUAACGGUAAGAAUUACAUUCAAGUCCGAGCGCCACCCAGUAUAGUCCGCUGUUGAAUGAUGGCCAGGAAAAGUCUAGUUCUACAAUUUUAAU
RS 3 dot ……..(((..((.(((…(((((…….)))))….)))))..))).((.(((((((.(((….(((..(.((((.(((((…….))))……).))))).)))..))).)))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table