Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092971 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA092971
Gene: RPS25
MFE: -24.946
ENS: 0.922
Length: 88.
Predicted Ligands:
glycine - 19/20
cyclic-di-GMP - 1/20

 RS: URS0000DA5289_1827382
MFE: -29.081
Ligand: glycine
Species: Proteobacteria bacterium SG_bin5 Glycine riboswitch
 RS: URS0000C26A49_1807500
MFE: -30.731
Ligand: glycine
Species: Branchiibius sp. NY16-3462-2 Glycine riboswitch
 RS: URS0000AB27A5_649638
MFE: -34.681
Ligand: cyclic-di-GMP
Species: Truepera radiovictrix DSM 17093 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092971 URS0000DA5289_1827382 URS0000C26A49_1807500 URS0000AB27A5_649638
Length 88. 88. 89. 87.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.922 - - -
MFE -24.946 -29.081 -30.731 -34.681
Ligands - glycine glycine cyclic-di-GMP
Gene RPS25 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 3.003 11.
Length SE - 0. 1. 1.
Lev Distance - 19. 21. 18.
UBS 7. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 0.
ILR 1. 1. 2. 4.
H 1. 1. 1. 1.
BL 4. 3. 3. 3.
BR 2. 3. 3. 2.
UN 0.057 0.023 0.112 0.069

Sequences

Field Description
UTR seq + 25 cuuccuuuuuguccgacaucuugacgaggcugcggugucugcugcuauucuccgagcuucgcaATGCCGCCTAAGGACGACAAGAAGA
UTR dot + 25 ….(((((((((((.(((..((.(((((((.(((.(…………).))))))))))))))).))………))))))))).
RS 1 seq CGGGCGCUCGCGGGAGAGUGUGGAGCUAUUCCACCGCCGAAGGAGCAACCGCCCCGGAAUCUCUCAGGCAACCGGACCGCAGCGCUUA
RS 1 dot .(((((((.((((….((.(((((..(((((………((.((….)).)))))))))).)).))…….))))))))))).
RS 2 seq CGACGCCGGGUGGGAGAGCUUCCGAUAGGGAAGCGCCGACGGGGCAACUCUCCCCAGAACCUCUCAGGCACCAGGACCAUCCGGAAGAG
RS 2 dot …..(((((((((((((.(((.(…((((((.(((…..)))..)).))))).))).)))))………..))))))))…..
RS 3 seq CCGCCCCUCGGAGGCUUUGACACCCGUUUCCUGUAUAUGGGCGCUUGGGAGCGGGUCGAGCCAGUAGCGCAACCGGCCGAGGGGAGC
RS 3 dot …((((((((.(((((((.(((((((((((.((……..))..)))))))))).)…))).)))…..)..))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table