Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092984 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA092984
Gene: RPS27
MFE: -13.381
ENS: 0.979
Length: 59.
Predicted Ligands:
fluoride - 13/20
glutamine - 6/20
unknown - 1/20
 RS: URS0000D9EA5C_1617448
MFE: -10.467
Ligand: glutamine
Species: Geminocystis sp. NIES-3709 Glutamine riboswitch
 RS: URS0000C4EF48_1134406
MFE: -13.674
Ligand: fluoride
Species: Ornatilinea apprima Fluoride riboswitch
 RS: URS0000BF78B9_485916
MFE: -14.930
Ligand: fluoride
Species: Desulfotomaculum acetoxidans DSM 771 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092984 URS0000D9EA5C_1617448 URS0000C4EF48_1134406 URS0000BF78B9_485916
Length 59. 60. 60. 58.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.979 - - -
MFE -13.381 -10.467 -13.674 -14.930
Ligands - glutamine fluoride fluoride
Gene RPS27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.021 3. 3.001
Length SE - 1. 1. 1.
Lev Distance - 14. 15. 15.
UBS 4. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 1. 0. 0. 0.
H 3. 2. 3. 3.
BL 0. 1. 0. 0.
BR 0. 1. 1. 0.
UN 0.203 0.350 0.183 0.241

Sequences

Field Description
UTR seq + 25 cuuuccggcggugacgaccuacgcacacgagaacATGCCTCTCGCAAAGGATCTCCTTC
UTR dot + 25 …..((..(((….)))..))….(((((…….)))))..((((….)))).
RS 1 seq AUCGUUCAUCUGUUUAGGCAGACGGAAGUAAGAAGUAAUAAUCUUCUGAAGGAACGCGCC
RS 1 dot ….(((.(((((….))))).)))….(((((…….)))))………….
RS 2 seq CAAUAAUAUGGCGAUGAGGCUCGCUAAAACUGUCACCCGACUGAUGGCCUCUACUGAGCG
RS 2 dot ……..((((((……))))))…((((((……))))))((((….))).)
RS 3 seq AAAAUGUAUGGCGAUGGAGCUCGCCUAAUGCUGUUAAGCUGAUGGCUCCUACCAGGAC
RS 3 dot ………(((((……)))))….(((((((…)))))))((((…)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table