Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA092990 Similarity: 0.971 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA092990
Gene: RPS27A
MFE: -22.084
ENS: 0.871
Length: 129.
Predicted Ligands:
cobalamin - 6/20
TPP - 6/20
FMN - 4/20
RS: URS0002312139_479435
MFE: -55.557
Ligand: cobalamin
Species: Kribbella flavida DSM 17836 Cobalamin riboswitch
RS: URS000231DD58_317936
MFE: -29.214
Ligand: cobalamin
Species: Nostoc sp. PCC 7107 Cobalamin riboswitch
RS: URS0000D8C4C7_1797950
MFE: -44.917
Ligand: FMN
Species: Elusimicrobia bacterium RIFCSPLOWO2_02_FULL_61_11 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA092990 URS0002312139_479435 URS000231DD58_317936 URS0000D8C4C7_1797950
Length 129. 130. 129. 127.
Similarity - 0.971 0.969 0.969
Ensemble Norm 0.871 - - -
MFE -22.084 -55.557 -29.214 -44.917
Ligands - cobalamin cobalamin FMN
Gene RPS27A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.012 3.001 3.001
Length SE - 1. 0. 4.
Lev Distance - 35. 41. 36.
UBS 9. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 3.
ILR 3. 4. 2. 3.
H 3. 4. 3. 3.
BL 2. 1. 1. 1.
BR 2. 1. 2. 2.
UN 0.155 0.046 0.124 0.181

Sequences

Field Description
UTR seq + 25 gccacguugauuguacgggaaaagccuuuuuaaaacaucuuuuacguugcuuaaaccuacaguuucgaaagcauuccgaaggcuaaaguggagccgccaccaaaATGCAGATTTTCGTGAAAACCCTTA
UTR dot + 25 ((..((..(((((((.((…((((…..(((((….)))))….))))…))))))))).))…))……..((((…….))))..(((.(((((….))))).)))……….
RS 1 seq GUGGAAUGAUCGCCCGGACGGUUGAAGAGGAACACCGGUGACGGCCUGGCGGCCGGAGUCCGGGGCGGUCCCGCCACUGUGACCGGAGCGAUCCGGAAGCCAGGACAUCUUCGUCCGUCCGCCAGGGAGC
RS 1 dot ((((…(((((((((((((((((..(.((….(((….))))))..)))))…))))))).)))))…)))).((..(((((….)))))..))..((((……)))).(((…..)))..
RS 2 seq UUCCGCAGACAGUCUCAUGGUAAAUUACUAAAGCUUAGAGUUGGGAAACUCCGGUGAAAUUCCGGGACUGUGCCGCAGCUGUGAAGGGAAAUCCCAAGUCAGAAUGCCAACUCCGGGGUGUCUAAAAGA
RS 2 dot …(((((((((((((..((….(((((…(….(((((….)))))))))))….))))))))))…….)))))..(((….)))…..(((((.((……)).)).)))……
RS 3 seq UAAGUUCUUCAGGGCGGGGCGAGAUUCCCCACCGGCGGUAACCCGAAAGGGAAGCCCGCAAGCCCGCAAGGGCAGACCCGGUUAAAUUCCGGGGCCGACGGUAAAGUCCGGAUGAAAGAAGAACGCG
RS 3 dot …((((((..(((((((((….(((((…(((.(….))))…))))))))).)..))))..))))))…(((((…….))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table