Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093059 Similarity: 0.967 Similarity: 0.962 Similarity: 0.960
UTR: 5HSAA093059
Gene: RPS4Y1
MFE: -25.737
ENS: 0.812
Length: 140.
Predicted Ligands:
cobalamin - 8/20
FMN - 8/20
SAM - 3/20
 RS: URS0002335857_443255
MFE: -44.409
Ligand: cobalamin
Species: Streptomyces clavuligerus ATCC 27064 Cobalamin riboswitch
 RS: URS0000C1A4BB_1795630
MFE: -54.085
Ligand: FMN
Species: Frondihabitans sp. PAMC 28766 FMN riboswitch (RFN element)
 RS: URS000232E9F2_1283301
MFE: -62.238
Ligand: cobalamin
Species: Streptomyces afghaniensis 772 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093059 URS0002335857_443255 URS0000C1A4BB_1795630 URS000232E9F2_1283301
Length 140. 140. 139. 141.
Similarity - 0.967 0.962 0.960
Ensemble Norm 0.812 - - -
MFE -25.737 -44.409 -54.085 -62.238
Ligands - cobalamin FMN cobalamin
Gene RPS4Y1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 3.009 2.010
Length SE - 0. 1. 1.
Lev Distance - 41. 48. 51.
UBS 13. 12. 14. 13.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 3.
ILR 5. 3. 4. 4.
H 1. 1. 1. 1.
BL 6. 6. 6. 6.
BR 7. 6. 7. 7.
UN 0.121 0.150 0.029 0.021

Sequences

Field Description
UTR seq + 25 aagaagcacuuaaagcguguugcagcgccgaagcauuggaugcuugacaaacuaacggguguauuugaauagacucaaguaugcguugacuggagaugagguaaagaagauauguATGGCCCGGGGCCCCAAGAAGCACT
UTR dot + 25 …………..((.(.(((..((.(((..((..((.((((((.(….(((.(((((((((((((……)))))))))).)))..)))…).))))………)).))..)).))).))..))).).))…
RS 1 seq UCAUCGCCACCACAUGUAUGCUCAUCUCGCUGUCGACGCAGAGGAAUCCGGUGGGAAUCCGGAACUGUCCCGCAACGGUGUGCUGUGGUGCCUUUGUCGUACCCGCAAGUCCGGACGUCUGCCGACAGCGCGCCCGGCUC
RS 1 dot ……………….(((…(.((((((((..(((((.(..(((((((((.((.((((…((.(((((.(…..).))))).)).))))..)).))))…..)))))).))))))))))))).)…)))..
RS 2 seq AACGCGCUCCGGGGUCAGUGAAAAUCUGUACCGGCGGUAUAGUCCGCGACCCGCUCGAGUCUCAGCAGUGAGAGUCGGGCGGCUGAACUGGUGUGAUUCCAGUACCGACGGUUAAAGUCCGGAUACGAGGCAGCGCGCG
RS 2 dot ..((((((((..((((.(.((….((..((((.(((((((((((((.(.((((((((.(((((….))))).))))))))……).))).))))…)))))).))))…))))).))).)..)).))))))..
RS 3 seq GGCUGUUCCCGGCCGUGGUGGACUGCCGGGGCCAGUACGGCGGCAGGAGAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGCAAUCCCCGGGAGCCAGGAACUCUCACCGCCGGUCUAGUCGAA
RS 3 dot (((((…(((((.(((((((.((.((((((((.((((((.(((.(((..(…(((((…….))))).)..))).))).)))).)).))………)))))).)))))…….)))).)))))..)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table