Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093061 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA093061
Gene: RPS4Y2
MFE: -29.760
ENS: 0.947
Length: 121.
Predicted Ligands:
FMN - 19/20
Mg2+ - 1/20

 RS: URS0000ABAED9_386415
MFE: -30.454
Ligand: FMN
Species: Clostridium novyi NT FMN riboswitch (RFN element)
 RS: URS0000AB7AB3_293826
MFE: -28.475
Ligand: FMN
Species: Alkaliphilus metalliredigens QYMF FMN riboswitch (RFN element)
 RS: URS0000C1E8C0_1423790
MFE: -30.694
Ligand: FMN
Species: Lactobacillus pasteurii DSM 23907 = CRBIP 24.76 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093061 URS0000ABAED9_386415 URS0000AB7AB3_293826 URS0000C1E8C0_1423790
Length 121. 120. 122. 120.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.947 - - -
MFE -29.760 -30.454 -28.475 -30.694
Ligands - FMN FMN FMN
Gene RPS4Y2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 4. 7.024
Length SE - 1. 1. 1.
Lev Distance - 32. 34. 33.
UBS 6. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 1. 1. 1. 2.
H 3. 4. 4. 4.
BL 1. 0. 0. 1.
BR 1. 2. 2. 1.
UN 0.339 0.317 0.328 0.183

Sequences

Field Description
UTR seq + 25 cugaaauucucacucauuugacuucccgcuguuuaucaccgcagauuacgguugcaccguaaaaggagagguucuguuccgucgcgggauuucgccATGGCCCGGGGCCCCAAGAAGCACT
UTR dot + 25 ……………………….((((……..)))).(((((((…)))))))..((…(((((((..((((.((((….)))).))))..)))))))))……….
RS 1 seq UUAAUCCUUCAGGGCAGGGUGAAAUUCCCGACCGGCGGUAAAGUCCGCGAGCCACUUUAGUGGUUGAUUUGGUGAGAUUCCAAGACCGACAGUAAAGUCUGGAUGGGAGAAUAGGAUUAA
RS 1 dot …………((..(((…….)))..)).((((……)))).((((((….))))))…………(((((…(((((……))).)).)))))…………
RS 2 seq UAAAAUCUUCAGGGCAGGGUGAAAUUCCCGACCGGCGGUUAGAGUCCGCGACUCAACAUAAUGUUGAUUGAUCUGGUGAAAUUCCAGUACCGACAGUAAAGUCUGGAUGGAAGAAGAGCAAG
RS 2 dot …………((..(((…….)))..)).((((…….))))…((((((…))))))…………..(((((…(((((……))).)).)))))……….
RS 3 seq UUUAGUCUUCAAGGCAGGGUGAAAUUCCCGACCGGCGGUAAAGUCCGCAACCCACUAUUUUUGUAGUGGCUGAACCCGUAAUGGUACCGAUAGUUAUAGUCUAGAUGGGAGAAGUUAAUU
RS 3 dot …………((..(((…….)))..)).((((……))))…(((((((….)))))))((…(((((..(((.((………..))))).)))))…))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table